Invest Clin 66(1): 63 - 77, 2025 https://doi.org/10.54817/IC.v66n1a06

Corresponding author: YanHong Gai, Qingdao Central Hospital, University of Health and Rehabilitation Scien-

ces, Department of Cardiology, QingDao, 266042, China. Contact Number: +8618561858500.

E-mail: gai7371@outlook.com

Phyllanthin from Phyllanthus amarus

protects the myocardium during pressure

overload-induced cardiac hypertrophy by

inhibiting the angiotensin-converting enzyme.

Changyou Zhu1, ZhiHua Liu2 and YanHong Gai3

1Jinan Third People’s Hospital Geriatric Medicine, JiNan, China.

2Qingdao Central Hospital, University of Health and Rehabilitation Sciences,

Department of Rehabilitation, QingDao, China.

3Qingdao Central Hospital, University of Health and Rehabilitation Sciences,

Department of Cardiology, QingDao, China.

Keywords: angiotensin-converting enzyme; aortic stenosis; cardiac hypertrophy;

collagen-I; Phyllanthin; Phyllanthus amarus; pressure overload.

Abstract. Ischemic heart disease results from obstruction of blood flow and

leads to myocardial infarction. Various lignans of herbal origin have been shown

to protect against cardiotoxicity. The present study aimed to assess the poten-

tial of phyllanthin, identified from a standardized methanolic extract of Phyl-

lanthus amarus (PAME), against pressure overload-induced cardiac hypertrophy

in experimental rats. Lignan was identified in PAME using HPLC. Ligating the

abdominal aorta induced cardiac hypertrophy in Wistar rats (220-240g). Then

they were treated with (n=15, each) either distilled water (10 mL/kg, aortic

stenosis control), lisinopril (15 mg/kg), or PAME (50, 100 and 200 mg/kg) for

28 days. Lignan compounds were identified using UV spectra in PAME, and HPLC

analysis showed the presence of phyllanthin at 25.30 retention time with an area

of 70.22%. Treatment with PAME (100 and 200 mg/kg) significantly and dose-de-

pendently (p<0.01 and p<0.001) ameliorated AS-induced elevation in absolute

and relative heart weights, increased serum biomarker levels, and alterations in

electrocardiographic and hemodynamic functions. PAME effectively inhibited AS-

induced oxide-nitrosative stress dose-dependently (p<0.01 and p<0.001). Up-

regulated mRNA expression of cardiac angiotensin-converting enzyme (ACE) and

Collagen-I were also markedly inhibited (p<0.01 and p<0.001) by PAME. Fur-

thermore, PAME significantly reduced (p<0.01 and p<0.001) pressure overload-

induced alterations in cardiac histopathology. In conclusion, phyllanthin identi-

fied from P. amarus ameliorated pressure overload-induced cardiac hypertrophy

by inhibiting ACE and collagen-I formation pathways to alleviate hypertension

and fibrosis. These findings collectively suggest that P. amarus represents prom-

ising therapy for managing ischemic heart diseases.

64 Zhu et al.

Investigación Clínica 66(1): 2025

La filantina de la Phyllanthus amarus protegió el miocardio

durante la hipertrofia cardíaca inducida por sobrecarga

de presión mediante la inhibición de la enzima convertidora

de angiotensina.

Invest Clin 2025; 66 (1): 63 – 77

Palabras clave: Enzima convertidora de angiotensina; estenosis aórtica; hipertrofia cardíaca;

colágeno-I; Filantina; Phyllanthus amarus; sobrecarga de presión.

Resumen. La cardiopatía isquémica es el resultado de la obstrucción del

flujo sanguíneo del corazón y conduce al infarto de miocardio. Se ha demostra-

do que varios lignanos de origen herbario protegen contra la cardiotoxicidad. El

presente estudio tuvo como objetivo evaluar el potencial de la filantina, identi-

ficada a partir de un extracto metanólico estandarizado de Phyllanthus amarus

(PAME), contra la hipertrofia cardíaca inducida por sobrecarga de presión en

ratas experimentales. El lignano se identificó en PAME mediante HPLC. La liga-

dura de la aorta abdominal indujo hipertrofia cardíaca en ratas Wistar (220-240

g). Luego se las trató con (n = 15, cada una) agua destilada (10 ml/kg, control

de estenosis aórtica), lisinopril (15 mg/kg) o PAME (50, 100 y 200 mg/kg) du-

rante 28 días. Los compuestos de lignano se identificaron utilizando espectros

UV en PAME, y el análisis de HPLC mostró la presencia de filantina en un tiempo

de retención de 25,30 con un área de 70,22%. El tratamiento con PAME (100 y

200 mg/kg) mejoró significativamente y de manera dosis-dependiente (p<0,01

y p<0,001) la elevación inducida por AS en los pesos cardíacos absolutos y re-

lativos, aumentó los niveles de biomarcadores séricos y las alteraciones en las

funciones electrocardiográficas y hemodinámicas. PAME inhibió eficazmente el

estrés óxido-nitrosativo inducido por AS de manera dosis-dependiente (p<0,01

y p<0,001). La expresión de ARNm regulada al alza de la enzima convertidora

de angiotensina cardíaca (ECA) y el colágeno-I también fueron inhibidos no-

tablemente (p<0,01 y p<0,001) por PAME. PAME redujo significativamente

(p<0,01 y p<0,001) las alteraciones inducidas por sobrecarga de presión en la

histopatología cardíaca. En conclusión, la filantina identificada en P. amarus

mejoró la hipertrofia cardíaca inducida por sobrecarga de presión al inhibir las

vías de formación de la ECA y del colágeno-I para aliviar la hipertensión y la

fibrosis. Estos hallazgos en conjunto sugieren que P. amarus ofrece una terapia

prometedora para el manejo de las enfermedades cardíacas isquémicas.

Received: 19-12-2024 Accepted: 18-01-2025

INTRODUCTION

Ischemic heart disease (IHD) is the

most prevalent cardiovascular disease (CVD)

and is characterized by the accumulation of

plaques within the walls of the coronary ar-

teries, resulting in a decreased flow of blood

to the cardiac tissue 1. This obstruction

of blood flow leads to acute coronary syn-

dromes such as unstable angina or myocar-

dial infarction 2. IHD significantly impacts

long-term global development and, as per

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 65

Vol. 66(1): 63 - 77, 2025

the World Health Organization reports, an

annual toll of 17.7 million lives lost to IHD,

imposing a pervasive social and economic

burden globally 3.

Treatment interventions to manage

IHD include antiplatelet agents (such as as-

pirin or clopidogrel) to reduce the risk of

thrombosis, statins (such as lovastatin, ator-

vastatin, simvastatin, and rosuvastatin) to re-

duce the risk of atherosclerosis, beta-block-

ers (such as timolol, metoprolol, atenolol,

and propranolol) to decrease heart rate and

blood pressure, calcium channel blockers

(such as amlodipine, nicardipine, diltiazem,

verapamil) to enhance blood flow to the car-

diac tissue, angiotensin-converting enzyme

(ACE) inhibitors (lisinopril), or angiotensin

receptor blockers to lower blood pressure

and improve heart function 4. Despite ex-

tensive exploration of these treatment regi-

mens, their side effects, such as toxicity to

various organs, limit their availability as de-

finitive therapeutic or prophylactic interven-

tions for managing IHD 5. However, the cost

of treatment and its efficacy in a fraction of

patients limit its implications for optimizing

patient outcomes and improving quality of

life. Thus, for the effective management of

IHD, a multidisciplinary approach is needed.

Among the diverse species of medici-

nal plants, the Phyllanthus spp. (Euphorbia-

ceae) has been used in traditional medicine

for thousands of years and in Thai folk medi-

cine for treating various ailments, includ-

ing diabetes, diarrhea, hepatitis, abdominal

pain, and various kidney diseases 6. Among

the Phyllanthus spp., Phyllanthus amarus

Schum. & Thonn. (Euphorbiaceae) is a valu-

able medicinal plant, extensively distributed

across tropical and subtropical zones, includ-

ing Asia, Africa, the West Indies, and South

America 7. P. amarus has been extensively

studied for its hepatoprotective, antiviral,

antiulcer, antiepileptic, anti-asthmatic, anti-

diabetic, anti-inflammatory, anticancer, and

antioxidant properties 8-12. Pharmacological

studies have reported that various bioactive

compounds, including alkaloids, polyphe-

nols, tannins, flavonoids, sterols, volatile

oils, lignans, and triterpenes are responsible

for this array of pharmacological activities.

Phyllanthin and hypophyllanthin from P.

amarus have been reported as inflammatory

markers, including tumor necrosis factor-α

(TNF-α), which exerts their antiulcer poten-

tial 12. Furthermore, the inhibitory effect of

phyllanthin on TNF-α, interleukins, heme ox-

ygenase-1, and transforming growth factor-

beta supports its anti-asthmatic properties

11. However, its potential against IHD is yet

to be evaluated. This study aimed to assess

the potential of phyllanthin identified from

a standardized methanolic extract of Phyl-

lanthus amarus aerial parts against pressure

overload-induced cardiac hypertrophy in ex-

perimental rats.

MATERIALS AND METHODS

Animals

Ninety adult Wistar rats (male, 220-

240 g, 7-8 weeks, were purchased from the

animal house of Qingdao Central Hospital),

with the following housing considerations:

temperature: 24°C±1°C, relative humidity:

45-55%, normal dark/light cycle with free

access to standard pellet chow and water.

The Qingdao Central Hospital approved the

experimental protocol (Protocol Number:

559974002). All surgeries were performed

under sodium thiopental anesthesia, and ef-

forts were made to minimize suffering.

Preparation and identification

of a standardized methanolic extract

of P. amarus

This procedure was performed accord-

ing to a previously reported method 12. Brief-

ly, the quantity (500 g) of air-dried powder

(Mesh size-16) of the aerial parts of P. ama-

rus was macerated with distilled methanol at

room temperature by soaking and eventually

stirring for seven days and then filtered. The

filtrate was dried in a tray dryer and main-

tained at 40°C. A semi-solid methanolic ex-

tract of P. amarus (PAME) was obtained, and

66 Zhu et al.

Investigación Clínica 66(1): 2025

colloidal silicon dioxide was added and dried

in a vacuum tube dryer. Phytochemical anal-

ysis of PAME was performed to identify phyl-

lanthin content using high-performance liq-

uid chromatography (HPLC). Analyses were

conducted using an HPLC system (Camag,

Muttenz, Switzerland) with an RP C18, 5µ,

250 X 4.6 mm, and 1.5 mL/min flow rate.

Acetonitrile: Buffer (40:60 v/v) was used as

the mobile phase for isolation and detection.

The buffer consisted of 0.136 g of potassium

hydrogen phosphate and 0.5 mL of o-phos-

phoric acid. The optimum injection volume

was 20 µL, and the detection wavelength of

the detector was set to 230 nm. The autos-

ampler temperature was maintained at 10°C,

and the system pressure was 1000 psi.

Induction of pressure overload-induced

cardiac hypertrophy and treatment

schedule

Wistar rats were anesthetized using so-

dium thiopental (35 mg/kg, intraperitone-

ally) and the abdominal aorta above the left

renal artery was exposed by cutting the mid-

abdomen. Then, it was constricted using a

40 mm cannula (0.9 sizes) ligation and with-

drawn after 10 min 13. After a week of recov-

ery, the rats were randomly assigned to vari-

ous groups. The rats received the following

treatments (15 rats per group): aortic steno-

sis control (AS, received distilled water [DW],

10 mL/kg), lisinopril (15 mg/kg), and PAME

(50, 100, and 200 mg/kg). The dosages of

lisinopril (15 mg/kg) and PAME (50, 100, and

200 mg/kg) were selected based on previous

studies 9,12. Other groups of age- and body-

weight-matched sham rats were maintained

without aortic ligation and treated with DW

(10 mL/kg). Rats were treated orally with

DW, lisinopril, or PAME for 28 days.

Behavioral and biochemical determination

On the 29th day, blood was collected

using the retro-orbital puncture method

from anesthetized rats (urethane, 1.25 g/

kg, intraperitoneally), and serum (six rats

per group) was separated to evaluate the

parameters including creatine kinase-MB

(CK-MB), lactate dehydrogenase (LDH), and

alkaline phosphatase (ALP) using various

reagent kits (Accurex Biomedical Pvt. Ltd.,

Mumbai, India).

Electrocardiographic (ECG) and hemo-

dynamic functions (including heart rate and

blood pressure viz, systolic blood pressure

[SBP], diastolic blood pressure [DBP], and

mean arterial blood pressure [MABP]) were

estimated (six rats per group) after blood

collection using an AD Instrument data-ac-

quisition system (LabChart 7.3; AD Instru-

ment Pvt. Ltd., Australia).

Animals were sacrificed by cervical dis-

location. Cardiac tissue was isolated and

perfused with cold phosphate-buffered sa-

line to flush blood from the tissue and stored

at -70°C. A previously reported method was

used to determine the levels of total protein,

superoxide dismutase (SOD), reduced gluta-

thione (GSH), lipid peroxidation (MDA), and

nitric oxide (NO) in cardiac tissue homog-

enates (six rats per group) 14.

Reverse transcription polymerase chain

reaction (RT-PCR) analysis was used to de-

termine the messenger ribonucleic acid

(mRNA) expression of angiotensin-convert-

ing enzyme (ACE; forward primer: CCTGAT-

CAACCAGGAGTTTGCAGAG, reverse prim-

er: GCCAGCCTTCCCAGGCAAACAGCAC,

base pair: 303) and collagen-I (forward prim-

er: GAGCGGAGAGTACTGGATCG, reverse

primer: GGTTCGGGCTGATGTACCAG, base

pair: 218) in cardiac tissue (6 rats per group)

15,16. β-actin was used as a reference standard

(forward primer: GCCATGTACGTAGCCATC,

reverse primer: GAACCGCTCATTGCCGAT,

base pair: 375).

Finally, cardiac tissue from each

group (three rats per group) was isolat-

ed and fixed in 10% formalin for histo-

pathological evaluation. Briefly, cardiac

tissues were cut in sections of 3-5 𝜇m

thickness by microtome and stained by he-

matoxylin-eosin. The samples were mount-

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 67

Vol. 66(1): 63 - 77, 2025

ed by disterene phthalate xylene (DPX).

For myocardial fibers staining, Yuccafine™

Masson’s trichrome staining kit (Yucca

Diagnostics, India) was used. Each tissue

section’s photomicrographs were observed

using Cell Imaging software for Life Sci-

ence microscopy (Olympus Soft Imaging

Solution GmbH, Munster, Germany). Mi-

croscopic scoring (0-4) of histological ob-

servations (myocardial degeneration, in-

terstitial inflammation, and hemorrhage)

was performed by an experienced histolo-

gist, unaware of the treatment groups, as

described previously 15.

Statistical analysis

Data for all parameters (except his-

topathological findings) are expressed as

mean ± standard error of the mean (SEM),

and data for histopathological findings

are expressed as medians (Q1, Q3). Data

analysis was performed using the GraphPad

Prism software (version 5.0; GraphPad, San

Diego, CA, USA). Data were analyzed us-

ing one-way analysis of variance (ANOVA),

and Tukey’s multiple range test was used

for post hoc analysis. A value of p<0.05 was

considered to be statistically significant.

RESULTS

Isolation and identification of phyllanthin

from PAME

PAME had a 52.78% w/w yield with

glycosides, lignans, steroids, tannins, and

phenolic compounds. The lignan com-

pounds were identified by ultraviolet (UV)

spectroscopy (Fig. 1A). The total run time

for the HPLC column was 40 min, and

phyllanthin was identified at a retention

time (RT) of 25.30 min with an area of

70.22% (Fig. 1B).

Fig. 1. A – UV spectra of standardized P. amarus extract; and B – HPLC chromatogram showing the peak of

phyllanthin (RT: 25.30 min).

HPLC: High-performance liquid chromatography; mAU: milli-absorbance unit; min: minute; nm: nanomole;

RT: retention time; UV: ultraviolet.

68 Zhu et al.

Investigación Clínica 66(1): 2025

Effect of PAME on body weight

and relative heart Weight

The body weights of sham rats and rats

in the AS control and treatment groups did

not differ significantly. Ligation of the ab-

dominal aorta also did not cause any signifi-

cant change in the body weight of AS con-

trol rats compared to sham rats. Compared

to sham rats, ligation of the abdominal aor-

ta caused a significant increase (p<0.001)

in heart weight (absolute) and heart weight

to body weight ratio (relative heart weight)

in AS control rats. In contrast, treatment

with lisinopril (15 mg/kg) resulted in sig-

nificant attenuation (p<0.001) in absolute

and relative heart weights compared to the

AS control rats. Compared with AS control

rats, PAME (100 and 200 mg/kg)-treated

rats also showed a significant and dose-de-

pendent decrease (p<0.01 and p<0.001) in

absolute and relative heart weights. Admin-

istration of PAME (50 mg/kg) did not pro-

tect against AS-induced increase in cardiac

weight (Table 1).

Effect of PAME on electrocardiographic

and hemodynamic functions

Fig. 2 depicts AS-induced alterations in

electrocardiographic recordings and their

amelioration by PAME. The heart rate of AS

control rats was significantly (p<0.001) low-

er than that of sham rats. In contrast, treat-

ment with lisinopril (15 mg/kg) resulted in

a significant increase (p<0.001) in heart

rate when compared to the AS control rats.

Treatment with PAME (100 and 200 mg/kg)

resulted in a significant and dose-dependent

increase (p<0.01 and p<0.001) in heart

rate compared to that in the AS control rats

(Fig. 2 and Table 2).

There was a significant (p<0.001) pro-

longation in the QRS, QT, QTc, PR, RR, and

ST intervals in AS control rats compared with

sham rats. However, treatment with lisino-

pril (15 mg/kg) significantly (p<0.001) in-

hibited the prolongation of QRS, QT, QTc,

PR, RR, and ST intervals compared with AS

control rats. Treatment with PAME (100 and

200 mg/kg) also resulted in a significant

(p<0.001) decrease in QRS, QT, QTc, PR,

RR, and ST intervals compared to AS control

rats (Fig. 2 and Table 2).

SBP, DBP, and MABP in AS control rats

were significantly (p<0.001) lower than

those in sham rats. In contrast, treatment

with lisinopril (15 mg/kg) resulted in a sig-

nificant (p<0.001) increase in SBP, DBP,

and MABP in the AS control rats. Treatment

with PAME (100 and 200 mg/kg) also signif-

icantly and dose-dependently (p<0.01 and

p<0.001) increased SBP, DBP, and MABP

compared with the AS control rats (Table 2).

Effect of PAME on serum biochemistry

CK-MB, LDH, and ALP levels were sig-

nificantly (p<0.001) higher in the AS con-

trol rats than in the sham rats. Treatment

with lisinopril (15 mg/kg) significantly

(p<0.001) decreased CK-MB, LDH, and

ALP levels compared to AS control rats.

Treatment with PAME (100 and 200 mg/

kg) reduced the CK-MB, LDH and ALP sig-

nificantly and dose-dependently (p<0.001

and p<0.001) compared to AS control rats.

However, there was no significant decrease

in CK-MB, LDH, and ALP levels in PAME (50

mg/kg)-treated rats compared to those in

AS control rats (Table 1).

Effect of PAME on cardiac total protein,

SOD, GSH, MDA, and NO levels

Cardiac SOD and GSH levels in the

AS control rats were significantly lower

(p<0.001) than those in the sham rats.

SOD and GSH levels in the cardiac tissue of

lisinopril (15 mg/kg)-treated rats were sig-

nificantly higher (p<0.001) than those in

the AS control rats. Treatment with PAME

(100 and 200 mg/kg) significantly and

dose-dependently attenuated (p<0.01 and

p<0.001) AS-induced decreased levels of

SOD and GSH compared to those in AS con-

trol rats (Table 3).

There was a significant increase

(p<0.001) in cardiac total protein, MDA,

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 69

Vol. 66(1): 63 - 77, 2025

Table 1. Effect of PAME on pressure overload-induced alterations in absolute heart weight, relative heart weight, serum CK-MB, LDH, and ALP.

Parameters Sham AS control L (15 mg/kg) PAME (50 mg/kg) PAME (100 mg/kg) PAME (200 mg/kg)

Body weight (in g) 236.20 ± 4.00 241.00 ± 2.99 239.70 ± 3.90 242.80 ± 4.08 240.30 ± 4.46 240.20 ± 4.76

Heart weight (in g) 0.30 ± 0.02 0.90 ± 0.05### 0.40 ± 0.05*** 0.85 ± 0.03 0.61 ± 0.03** 0.47 ± 0.04***

Heart weight/Body

weight (X10-3)

1.27 ± 0.06

3.76 ± 0.21###

1.65 ± 0.19***

3.52 ± 0.15

2.56 ± 0.13**

1.96 ± 0.15***

Serum CK-MB

(in IU/L)

1057.00 ± 56.33

2102.00 ± 66.24###

1268.00 ± 39.52***

1952.00 ± 37.08

1658.00 ± 50.04**

1317.00 ± 50.54***

Serum LDH

(in IU/L)

1356.00 ± 73.39

2733.00 ± 62.75###

1666.00 ± 71.75***

2748.00 ± 51.49

2025.00 ± 51.74**

1601.00 ± 110.9***

ALP (in mg %) 117.60 ± 4.98 341.70 ± 5.21### 137.20 ± 12.82*** 318.20 ± 10.28 259.10 ± 7.15** 154.80 ± 11.5***

Data are expressed as mean ± SEM (six rats per group) and analyzed by one-way variance analysis followed by Tukey’s multiple range test. **p<0.01 and

***p<0.001 as compared to the AS control rats, ###p<0.001 as compared to the sham rats. AS: aortic stenosis control rats; L (15): lisinopril (15 mg/kg)-trea-

ted rats; PAME (50, 100, and 200 mg/kg); Phyllanthus amarus methanolic extract-treated rats. The numbers in parentheses in the table header represent the

doses of the respective treatments in mg/kg. ALP: alkaline Phosphatase; AS: aortic stenosis; CK-MB: creatine Kinase-MB; g: gram; IU/L: international units

per liter; kg: kilogram; L: lisinopril; LDH: lactate dehydrogenase; mg: milligram; PAME: Phyllanthus amarus methanolic extract; SEM: standard error means.

Table 2. Effect of PAME on pressure overload-induced alterations in electrocardiographic and hemodynamic.

Parameters Sham AS control L (15 mg/kg) PAME (50 mg/kg) PAME (100 mg/kg) PAME (200 mg/kg)

Heart Rate (in BPM) 363.70 ± 13.70 271.00 ± 5.82### 321.00 ± 10.64*** 276.20 ± 7.80 300.70 ± 11.90** 344.5.00 ± 13.72***

QRS interval (in ms) 12.33 ± 0.67 34.17 ± 0.87### 16.17 ± 0.54*** 30.00 ± 0.93 23.33 ± 1.17*** 21.33 ± 0.88***

QT Interval (in ms) 47.33 ± 2.77 92.00 ± 2.62### 60.50 ± 3.14*** 85.00 ± 3.45 69.67 ± 2.46*** 64.00 ± 1.29***

QTc Interval (in ms) 130.30 ± 4.61 177.80 ± 4.74### 143.50 ± 1.46*** 168.70 ± 3.72 148.20 ± 5.26*** 144.50 ± 6.16***

PR interval (in ms) 14.00 ± 0.58 29.50 ± 0.76### 17.33 ± 0.99*** 28.67 ± 0.56 24.33 ± 1.12*** 22.00 ± 0.68***

RR interval (in ms) 151.70 ± 4.55 215.50 ± 4.00### 160.80 ± 4.35*** 206.70 ± 5.54 177.50 ± 5.57*** 171.70 ± 5.43***

ST interval (in ms) 12.00 ± 0.58 35.50 ± 0.76### 15.33 ± 0.99*** 32.67 ± 0.56 26.33 ± 1.12*** 24.00 ± 0.68***

SBP (in mmHg) 152.50 ± 3.76 106.30 ± 2.91### 151.30 ± 4.42*** 116.50 ± 1.34 131.00 ± 1.84** 137.80 ± 2.86***

DBP (in mmHg) 116.00 ± 2.99 88.33 ± 3.54### 111.30 ± 3.75*** 95.67 ± 4.57 97.17 ± 4.19** 107.50 ± 3.53***

MABP (in mmHg) 120.50 ± 2.41 93.83 ± 1.72### 116.00 ± 1.29 101.30 ± 2.86 105.00 ± 2.63** 110.00 ± 2.00***

Data are expressed as mean ± SEM (six rats per group) and analyzed by one-way variance analysis followed by Tukey’s multiple range test. **p<0.01 and

***p<0.001 as compared to the AS control rats, ###p<0.001 as compared to the sham rats. AS: aortic stenosis control rats; L (15): lisinopril (15 mg/kg)-

treated rats; PAME (50, 100, and 200 mg/kg); Phyllanthus amarus methanolic extract-treated rats. The numbers in parentheses in the table header represent

the dose of the respective treatment in mg/kg. AS: aortic stenosis; BPM: beats per minute; DBP: diastolic blood pressure; kg: kilogram; L: lisinopril; MABP:

mean arterial blood pressure; mg: milligram; mmHg: millimeters of mercury; ms: millisecond; PAME: Phyllanthus amarus methanolic extract; SBP: systolic

blood pressure; SEM: standard error means.

70 Zhu et al.

Investigación Clínica 66(1): 2025

and NO levels in AS control rats compared to

sham rats. Administration of lisinopril (15

mg/kg) significantly (p<0.001) decreased

total protein, MDA, and NO levels in cardiac

tissue compared with those in AS control

rats. Treatment with PAME (100 and 200

mg/kg) also significantly and dose-depend-

ently (p<0.01 and p<0.001, respectively)

decreased the cardiac total protein, MDA,

and NO levels compared to AS control rats

(Table 3).

Effect of PAME on cardiac ACE

and collagen-I mRNA expressions

Compared with sham rats, cardiac ACE

and collagen-I mRNA expressions were sig-

Fig. 2. Effect of PAME on pressure overload-induced alterations on electrocardiograms. A representative elec-

trocardiographic tracing from A – sham rats; B – AS control rats; C – lisinopril (15 mg/kg)-treated

rats; D – PAME (50 mg/kg)-treated rats; E – PAME (100 mg/kg)-treated rats; and F – PAME (200 mg/

kg)-treated rats. AS: aortic stenosis; kg: kilogram; L: lisinopril; mg: milligram; PAME: Phyllanthus

amarus methanolic extract.

Table 3

Effect of PAME on pressure overload-induced alterations in cardiac oxido-nitrosative stress.

Parameters Sham AS control L

(15 mg/kg)

PAME

(50 mg/kg)

PAME

(100 mg/kg)

PAME

(200 mg/kg)

SOD (in U/mg of protein) 9.29 ± 0.44 4.08 ± 0.61### 6.66 ± 0.62*** 4.08 ± 0.68 5.60 ± 0.61*** 6.25 ± 0.87***

GSH (in µg/mg protein) 0.35 ± 0.02 0.22 ± 0.01### 0.34 ± 0.02*** 0.25 ± 0.02 0.26 ± 0.02** 0.36 ± 0.02***

MDA (in nmol/L/mg

of protein)

2.46 ± 0.32

7.17 ± 0.29###

3.47 ± 0.29***

6.56 ± 0.35

4.67 ± 0.30**

3.35 ± 0.24***

NO (in µg/mg of protein) 212.90 ± 15.22 604.20 ± 14.52### 307.60 ± 10.31*** 552.60 ± 7.66 493.20 ± 17.84** 349.90 ± 6.36***

Total protein (in mg/mL

of tissue)

24.32 ± 3.06

60.35 ± 3.47###

33.76 ± 3.57***

56.89 ± 2.71

49.98 ± 3.15**

38.14 ± 2.60***

Data are expressed as mean ± SEM (six rats per group) and analyzed by one-way variance analysis followed by

Tukey’s multiple range test. **p<0.01 and ***p<0.001 as compared to the AS control rats, ###p<0.001 as compa-

red to the sham rats. AS: aortic stenosis control rats; L (15): lisinopril (15 mg/kg)-treated rats; PAME (50, 100, and

200 mg/kg); Phyllanthus amarus methanolic extract-treated rats. The numbers in parentheses in the table header

represent the dose of the respective treatment in mg/kg. µg: microgram; AS: aortic stenosis; GSH: glutathione pe-

roxidase; kg: kilogram; L: lisinopril; MDA: malondialdehyde; mg: milligram; mL: milliliter; nmol: nanomole; NO: ni-

tric oxide; PAME: Phyllanthus amarus methanolic extract; SEM: standard error means; SOD: superoxide dismutase.

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 71

Vol. 66(1): 63 - 77, 2025

nificantly upregulated in AS control rats.

Compared to AS control rats, ACE and colla-

gen-I mRNA expression in the cardiac tissue

of lisinopril (15 mg/kg)-treated rats was sig-

nificantly downregulated (p<0.001). Treat-

ment with PAME (50 mg/kg) failed to sig-

nificantly downregulate ACE and collagen-I

mRNA expression compared to AS control

rats. However, administration of PAME (100

and 200 mg/kg) significantly and dose-de-

pendently (p<0.01 and p<0.001) downregu-

lated ACE and collagen-I mRNA expression

compared to AS control rats (Fig. 3).

Effect of PAME on pressure overload-

induced alterations in cardiac

histopathology

Histopathological observations of the

heart from sham rats revealed a well-main-

tained architecture with sham myocardial

fibers and muscle bundles with well-defined

boundaries and mild infiltration of neu-

trophils (Fig. 4A). Hearts from AS control

rats showed significant (p<0.001) myo-

cardial degeneration, congestion, edema,

and infiltration of inflammatory cells with

a disorganized arrangement of muscle bun-

dles with no well-defined boundaries (Fig.

4B). Administration of lisinopril (15 mg/

kg) protected against AS-induced myocar-

dial damage, as reflected by a significant

(p<0.001) reduction in myocardial necro-

sis, inflammatory infiltration, and conges-

tion without any edema (Fig.4C). Heart sec-

tions from PAME (50 mg/kg)-treated rats

showed severe myocardial necrosis, inflam-

matory cell infiltration, congestion, and

edema (Fig. 4D). However, administration

of PAME (100 and 200 mg/kg) significantly

(p<0.001) reduced AS-induced myocardial

aberrations, as reflected by the presence

of mild to moderate myocardial necrosis,

inflammatory cell infiltration, congestion,

and edema (Fig. 4E and 4F). (Fig. 4G).

Fig. 3. A – Effect of PAME on pressure overload-induced alterations in cardiac ACE mRNA expression; and B – Effect

of PAME on pressure overload-induced alterations in cardiac collagen-I mRNA expression.

Data are expressed as mean ± SEM (six rats per group) and analyzed by one-way variance analysis followed by

Tukey’s multiple range test. **p<0.01 and ***p<0.001 as compared to the AS control rats, ###p<0.001 as compa-

red to the sham rats. L (15): lisinopril (15 mg/kg)-treated rats; PAME (50, 100, and 200 mg/kg); Phyllanthus ama-

rus methanolic extract-treated rats. The numbers in parentheses on the x-axis represent the doses of the respective

treatments in mg/kg. ACE: angiotensin-converting enzyme; AS: aortic stenosis; bp: base pair; kg: kilogram; L:

lisinopril; mg: milligram; mRNA: messenger ribonucleic acid; PAME: Phyllanthus amarus methanolic extract; SEM:

standard error means.

72 Zhu et al.

Investigación Clínica 66(1): 2025

DISCUSSION

This study investigated the potential of

phyllanthin isolated from P. amarus to pre-

vent pressure overload-induced cardiac hy-

pertrophy using various in vivo and ex vivo

parameters in experimental rats. This study

employed a comprehensive set of method-

ologies to assess the impact of P. amarus on

a spectrum of parameters, ranging from se-

rum biochemistry and electrocardiographic

function to molecular markers and histo-

pathological alterations. Assessment of se-

rum LDH, CK-MB, AST, ALT, and ALP levels

provides insights into the systemic effects of

constricted abdominal aorta and the poten-

tial mitigating role of P. amarus 12. Concur-

rently, evaluating electrocardiographic and

hemodynamic parameters allows for gaug-

ing the functional impact of P. amarus on

pressure overload-induced cardiac altera-

tions. This study investigated the levels of

SOD, GSH, MDA, and nitric oxide in the

cardiac tissue homogenates to unravel the

molecular underpinnings 12. The quantifica-

tion of cardiac markers, such as ACE and

collagen-I mRNA expressions, sheds light

on the specific influence of P. amarus on

the molecular pathways implicated in aor-

tic stenosis-induced cardiotoxicity. Finally,

histopathological evaluation of cardiac tis-

sues elucidated the morphological changes

induced by aortic stenosis and the efficacy

conferred by P. amarus. By addressing these

knowledge gaps, our study provides robust

evidence that phyllanthin from P. amarus

confers cardioprotective efficacy against

pressure overload-induced cardiac hypertro-

phy, and can be considered as an alternative

and complementary therapeutic strategy for

managing ischemic heart diseases.

Current circulating biomarkers used to

detect myocardial damage are classified as

(a) biomarkers with elevated levels directly

in the blood circulation due to systemic re-

actions after the myocardial toxicity events

Fig. 4. Effect of PAME on pressure overload-induced alterations in cardiac histopathology. Representative pho-

tomicrographs of heart sections from A – sham rats; B – AS control rats; C – lisinopril (15 mg/kg)-treated rats;

D – PAME (50 mg/kg)-treated rats; E – PAME (100 mg/kg)-treated rats; F – PAME (200 mg/kg)-treated rats; and

G – quantitative representation of the histological scores.

The sections were stained with hematoxylin-eosin, and images were captured at 40X. Data are expressed as the me-

dian (Q1, Q3) (three rats per group) and were analyzed using the non-parametric test. **p<0.01 and ***p<0.001 as

compared to the AS control rats, ###p<0.001 as compared to the sham rats. Microscopic changes in cardiac histo-

pathology include myocardial degeneration (red arrows), interstitial inflammation (yellow arrows), and interstitial

hemorrhage (black arrows). The numbers in parentheses represent the doses of the respective treatments in mg/kg.

AS: aortic stenosis; kg: kilogram; L: lisinopril; mg: milligram; PAME: Phyllanthus amarus methanolic extract; Q1:

first quadrant; Q3: third quadrant; SEM: standard error means.

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 73

Vol. 66(1): 63 - 77, 2025

viz. interleukins (IL-1β, IL-6), growth factors

(Insulin-like Growth Factor-1, and vascular

endothelial growth factor), (b) biomarkers

originating from damaged myocardial tis-

sues that are ultimately released into the

blood circulation, such as LDH and CK-MB;

and (c) biomarkers with abnormal serum

levels before the occurrence of myocardial

infarction event viz. ALP, AST, glucose, hepa-

ranase, copeptin 17,18. Specific biomarkers

directly involved in myocardial injury were

investigated in the current study, including

ALP, CK-MB, and LDH. According to previous

research, patients with myocardial damage

showed increased ALP, CK-MB, and LDH lev-

els, suggesting their importance during IHD

19. In the current study, stenotic rats showed

elevated serum levels of ALP, CK-MB, and

LDH; however, PAME treatment effectively

attenuated these elevations, suggesting its

cardioprotective potential.

Oxidative stress is critical in chronic in-

flammatory conditions, such as diabetes, can-

cer, cardiovascular diseases, neurodegenerative

diseases, and infections 20,21. The imbalance be-

tween pro-oxidants and antioxidants disrupts

tissue homeostasis, causing the overproduc-

tion of harmful reactive oxygen and nitrogen

species and leading to cell toxicity 22. Numer-

ous studies have documented the crucial role

of oxidative stress in pressure overload-induced

cardiac hypertrophy 1,13. A redox imbalance was

observed, as measured by increased levels of

MDA and nitric oxide, along with a reduction

in GSH and SOD activity 23,24. GSH is an impor-

tant intracellular antioxidant system pivotal in

neutralizing lipid peroxides via glutathione per-

oxidase (GPx)-mediated inactivation, generat-

ing glutathione disulphide as a byproduct 24,25.

Moreover, GSH is crucial for conjugation

with glutathione S-transferase (GST) to detox-

ify reactive species from lipid peroxidation and

other xenobiotics 26,27. Consequently, GSH de-

pletion compromises cellular integrity, induces

macromolecular damage, and fosters the accu-

mulation of its oxidized form, further contrib-

uting to electrical and contractile dysfunction.

A sudden influx of blood into the cardiac tissue

precipitates cardiac GSH depletion, perpetu-

ating the continual generation of oxygen-free

radicals. Similarly, SOD plays a pivotal role in

counteracting aortic stenosis-induced oxida-

tive stress 12,28. Superoxide radicals generated

at the injury site may modulate SOD levels, po-

tentially fostering superoxide anion accumula-

tion and the consequent myocardial damage29.

The current findings demonstrate that rats

with aortic stenosis exhibit elevated MDA and

nitric oxide activities and reduced SOD and

GSH activities in their cardiac tissues. However,

pretreatment with the P. amarus extract effec-

tively restored these imbalances by regulating

cardiac oxidative stress markers. Lignans have

been shown to inhibit oxidative stress 30. In ad-

dition, extensive research has highlighted the

antioxidant potential of P. amarus in both in

vitro and in vivo studies 8. Other studies have

highlighted the considerable antioxidant ca-

pacity of P. amarus extract against renal oxida-

tive stress markers induced by streptozotocin

in diabetic rats 9 and its ability to protect rat

liver mitochondria from oxidative damage 31.

Moreover, the methanolic extract of P. amarus

showed antioxidant properties against cyclo-

phosphamide-induced toxicity in mice by aug-

menting cellular GSH and GST levels 32. These

results emphasize and confirm the promising

antioxidant efficacy of P. amarus, suggesting

its potential against stenosis-induced cardiac

hypertrophy, which may be attributed to the

presence of its major bioactive lignan, phyllan-

thin.

Mammalian homeostasis is maintained

by the renin-angiotensin system, which

mainly comprises renin, Ang II, angioten-

sin-1 (AT1) receptors, angiotensinogen, and

ACE 33. Clinical and experimental studies

have established a link between angioten-

sin-converting enzyme inhibitors and blood

pressure regulation 34. Additionally, mount-

ing evidence suggests that the binding of

Ang II to AT1 receptors initiates ROS gener-

ation, which stimulates inflammation influx

in cardiac tissue, and their synergistic action

results in cardiac damage during ventricu-

lar hypertrophy 35. Accordingly, researchers

74 Zhu et al.

Investigación Clínica 66(1): 2025

have demonstrated that the administration

of ACE inhibitors to hypertensive patients

significantly decreases systemic vascular re-

sistance, thus reducing the risk of cardiac

failure and IHD 36. Furthermore, reduced

blood flow to the cardiac tissue causes a sig-

nificant drop in hydrostatic pressure in the

afferent arteriole, a major factor in the re-

lease of renin 37.

Moreover, long-term occlusion of the

cardiac aorta causes increased expression of

renin cells in the renal tissue, which are fur-

ther released into the systemic circulation,

where they interact with angiotensinogen.

Renin-induced cleavage of angiotensinogen

to AT1 and its further conversion to Ang II

by ACE is responsible for increased blood

pressure. In the present study, increased car-

diac ACE expression caused a significant el-

evation in blood pressure in AS control rats.

However, PAME treatment might counteract

ACE activation, thereby protecting against

cardiac hypertrophy.

Extensive research has suggested

that Phyllanthus niruri is effective against

pulmonary tuberculosis 38-40, vaginal can-

didiasis 41, urolithiasis 42, and shockwave

lithotripsy for renal lithiasis 43 in various

randomized controlled trials. This valida-

tion supports using Phyllanthus in treating

hepatitis and other chronic ailments. Clini-

cal studies have highlighted the efficacy of

P. amarus in the management of acute viral

hepatitis 44,45. Thus, based on the findings of

the present investigation, P. amarus should

be considered further to determine its clini-

cal efficacy in managing ischemic heart dis-

eases.

Our investigation revealed that phyl-

lanthin identified from P. amarus showed

cardioprotective effects against pressure

overload-induced cardiac hypertrophy,

likely through mechanisms involving (a)

ameliorating the alterations in electrocar-

diographic and hemodynamic parameters

and serum biochemical markers (CK-MB,

LDH, and ALP), (b) antioxidant effects

by modulating the alteration in the car-

diac oxide-nitrosative stress markers, (c)

inhibiting ACE and collagen-I formation

pathways to ameliorate hypertension and

fibrosis, and (d) preserving the histologi-

cal integrity of cardiac tissue against AS-

induced damage. These findings suggest

that P. amarus is a promising therapeutic

agent for managing ischemic heart dis-

eases.

ACKNOWLEDGMENTS

Medical writing support for the devel-

opment of this manuscript, under the direc-

tion of the authors, was provided by Yonnova

Scientific Consultancy following Good Publi-

cation Practice guidelines.

Funding

The authors (s) received no specific

funding for this study.

Data availability

The raw data underlying this article will

be shared with the corresponding author

upon reasonable request.

Ethical statements

The Qingdao Central Hospital approved

the experimental protocol (Protocol Num-

ber: 559974002). All surgeries were per-

formed under sodium thiopental anesthesia,

and efforts were made to minimize suffering.

Conflict of interest

The authors declare that they have no

conflicts of interest.

Authors´ ORCID

• ZhiHua Liu: 0009-0000-8801-7031

• Changyou Zhu: 0009-0005-2105-4395

• YanHong Gai: 0009-0003-9886-2572

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 75

Vol. 66(1): 63 - 77, 2025

Author contributions

Each author has made significant con-

tributions to the development of this man-

uscript. C.Z. conceived and designed the

evaluation, performed parts of the statistical

analysis, and drafted the manuscript; Z.L.

performed data acquisition and drafted the

manuscript. Y.G.: Performed parts of the sta-

tistical analysis and drafted the manuscript.

All authors read and approved the final ver-

sion of this manuscript.

REFERENCES

1. Visnagri A, Kandhare AD, Ghosh P, Bo-

dhankar SL. Endothelin receptor blocker

bosentan inhibits hypertensive cardiac

fibrosis in pressure overload-induced car-

diac hypertrophy in rats. Cardiovasc Endo-

crinol 2013;2:85-97.

2. Shivakumar V, Kandhare AD, Rajmane

AR, Adil M, Ghosh P, Badgujar LB et al.

Estimation of the long-term cardiovascular

events using UKPDS Risk Engine in meta-

bolic syndrome patients. Indian J Pharm

Sci 2014;76:174-178.

3. Sreeniwas Kumar A, Sinha N. Cardio-

vascular disease in India: A 360 degree

overview. Med J Armed Forces India

2020;76:1-3. https://doi.org/10.1016/j.mj

afi.2019.12.005

4. Eide S, Feng Z-P. Implications of age-rela-

ted changes in the blood-brain barrier for

ischemic stroke and new treatment strate-

gies. Advan Neurol 2022;1:1. https://doi.

org/10.36922/an.v1i2.1

5. Katyal J, Joshi D, Kumar Gupta Y. Effects

of losartan and enalapril on lithium-pilo-

carpine-induced status epilepticus, spon-

taneous convulsive seizures, and cardiac

changes in rats. Advan Neurol 2023;2:0387.

https://doi.org/10.36922/an.0387

6. Mao X, Wu LF, Guo HL, Chen WJ, Cui YP,

Qi Q et al. The Genus Phyllanthus: An eth-

nopharmacological, phytochemical, and

pharmacological review. Evid Based Com-

plement Alternat Med 2016;2016:7584952.

https://doi.org/10.1155/2016/7584952

7. Harikrishnan H, Jantan I, Haque MA,

Kumolosasi E. Anti-inflammatory effects

of hypophyllanthin and niranthin through

downregulation of NF-κB/MAPKs/PI3K-Akt

signaling pathways. Inflammation 2018;

41:984-995.

8. Bose Mazumdar Ghosh A, Banerjee A,

Chattopadhyay S. An insight into the

potent medicinal plant Phyllanthus ama-

rus Schum. and Thonn. The Nucleus

2022;65:437-472.

9. Karuna R, Bharathi VG, Reddy SS, Ra-

mesh B, Saralakumari D. Protective

effects of Phyllanthus amarus aqueous ex-

tract against renal oxidative stress in Strep-

tozotocin -induced diabetic rats. Indian J

Pharmacol 2011;43:414-418. https://doi.

org/10.4103/0253-7613.83112

10. Putakala M, Gujjala S, Nukala S, Bongu

SBR, Chintakunta N, Desireddy S. Car-

dioprotective effect of Phyllanthus amarus

against high fructose diet induced myo-

cardial and aortic stress in rat model. Bio-

med Pharmacother 2017;95:1359-1368.

https://doi.org/10.1016/j.biopha.2017.

09.054

11. Wu W, Li Y, Jiao Z, Zhang L, Wang X, Qin R.

Phyllanthin and hypophyllanthin from Phy-

llanthus amarus ameliorates immune-in-

flammatory response in ovalbumin-induced

asthma: role of IgE, Nrf2, iNOs, TNF-alpha,

and IL’s. Immunopharmacol Immunotoxi-

col 2019;41:55-67. https://doi.org/10.1080

/08923973.2018.1545788

12. Kandhare AD, Ghosh P, Ghule AE, Zam-

bare GN, Bodhankar SL. Protective effect

of Phyllanthus amarus by modulation of

endogenous biomarkers and DNA damage

in acetic acid induced ulcerative colitis:

Role of phyllanthin and hypophyllanthin.

Apollo Medicine 2013;10:87-97.

13. Ghule AE, Kandhare AD, Jadhav SS, Zan-

war AA, Bodhankar SL. Omega-3-fatty

acid adds to the protective effect of flax lig-

nan concentrate in pressure overload-indu-

ced myocardial hypertrophy in rats via mo-

dulation of oxidative stress and apoptosis.

Int Immunopharmacol 2015;28:751-763.

https://doi.org/10.1016/j.intimp.2015.

08.005

76 Zhu et al.

Investigación Clínica 66(1): 2025

14. Liu J, Han XC, Wang D, Kandhare AD,

Mukherjee-Kandhare AA, Bodhankar SL

et al. Elucidation of molecular mechanism

involved in nephroprotective potential of

naringin in fthylene glycol-induced uro-

lithiasis in experimental uninephrecto-

mized hypertensive rats. Lat Am J Pharm

2020;39:991-999.

15. Mukherjee AA, Kandhare AD, Bodhankar

SL. Elucidation of protective efficacy of

Pentahydroxy flavone isolated from Mad-

huca indica against arsenite-induced

cardiomyopathy: Role of Nrf-2, PPAR-

gamma, c-fos and c-jun. Environ Toxicol

Pharmacol 2017;56:172-185. https://doi.

org/10.1016/j.etap.2017.08.027

16. Tambewagh UU, Kandhare AD, Hon-

more VS, Kadam PP, Khedkar VM, Bod-

hankar SL et al. Anti-inflammatory and

antioxidant potential of Guaianolide iso-

lated from Cyathocline purpurea: Role

of COX-2 inhibition. Int Immunophar-

macol 2017;52:110-118. https://doi.

org/10.1016/j.intimp.2017.09.001

17. Wu Y, Pan N, An Y, Xu M, Tan L, Zhang L.

Diagnostic and prognostic biomarkers for

myocardial infarction. Front Cardiovasc

Med 2020;7:617277. https://doi.org/10.

3389/fcvm.2020.617277

18. Kandhare AD, Bandyopadhyay D, Thakur-

desai PA. Low molecular weight galacto-

mannans-based standardized fenugreek

seed extract ameliorates high-fat diet-in-

duced obesity in mice via modulation of

FASn, IL-6, leptin, and TRIP-Br2. RSC Adv

2018;8:32401-32416. https://doi.org/10.1

039/c8ra05204b

19. Edem E. Relationship between alkali-

ne phosphatase and impaired coronary

flow in patients with ST-segment eleva-

ted myocardial infarction. J Int Med Res

2018;46:3918-3927. https://doi.org/10.1

177/0300060518785544

20. Adil M, Kandhare AD, Ghosh P, Venkata

S, Raygude KS, Bodhankar SL. Ameliora-

tive effect of naringin in acetaminophen-

induced hepatic and renal toxicity in labo-

ratory rats: role of FXR and KIM-1. Ren Fail

2016;38:1007-1020. https://doi.org/10.31

09/0886022X.2016.1163998

21. Cui J, Wang G, Kandhare AD, Mukher-

jee-Kandhare AA, Bodhankar SL. Neu-

roprotective effect of naringin, a flavone

glycoside in quinolinic acid-induced neu-

rotoxicity: Possible role of PPAR-gamma,

Bax/Bcl-2, and caspase-3. Food Chem Toxi-

col 2018;121:95-108. https://doi.org/10.1

016/j.fct.2018.08.028

22. Thakkar H, Eerla R, Gangakhedkar S,

Shah RP. Exploring unexplored biomar-

kers of oxidative distress and their use.

Adv Redox Res 2021;3:100020. https://

doi.org/10.1016/j.arres.2021.100020

23. Honmore VS, Kandhare AD, Kadam PP,

Khedkar VM, Sarkar D, Bodhankar SL et

al. Isolates of Alpinia officinarum Hance

as COX-2 inhibitors: Evidence from anti-

inflammatory, antioxidant and molecular

docking studies. Int Immunopharmacol

2016;33:8-17. https://doi.org/10.1016/j.

intimp.2016.01.024

24. Visnagri A, Adil M, Kandhare AD, Bo-

dhankar SL. Effect of naringin on he-

modynamic changes and left ventricular

function in renal artery occluded renovas-

cular hypertension in rats. J Pharm Bioa-

llied Sci 2015;7:121-127. https://doi.

org/10.4103/0975-7406.154437

25. Bin Jardan YA, Ansari MA, Raish M,

Alkharfy KM, Ahad A, Al-Jenoobi FI et al.

Sinapic acid ameliorates oxidative stress,

inflammation, and apoptosis in acute

doxorubicin-induced cardiotoxicity via the

NF-κB-mediated pathway. Biomed Res Int

2020;2020.

26. Allocati N, Masulli M, Di Ilio C, Federi-

ci L. Glutathione transferases: substrates,

inihibitors and pro-drugs in cancer and

neurodegenerative diseases. Oncogene-

sis 2018;7:8. https://doi.org/10.1038/

s41389-017-0025-3

27. Kandhare AD, Bodhankar SL, Singh V,

Mohan V, Thakurdesai PA. Anti-asthmatic

effects of type-A procyanidine polyphenols

from cinnamon bark in ovalbumin-induced

airway hyperresponsiveness in laboratory ani-

mals. Biomed Aging Pathol 2013;3:23-30.

28. Ketkar S, Rathore A, Kandhare A, Lohi-

dasan S, Bodhankar S, Paradkar A et al.

Alleviating exercise-induced muscular

Phyllanthin-protected pressure overload-induced cardiac hypertrophy 77

Vol. 66(1): 63 - 77, 2025

stress using neat and processed bee po-

llen: oxidative markers, mitochondrial en-

zymes, and myostatin expression in rats.

Integr Med Res 2015;4:147-160. https://

doi.org/10.1016/j.imr.2015.02.003

29. Younus H. Therapeutic potentials of supe-

roxide dismutase. Int J Health Sci (Qas-

sim) 2018;12:88-93.

30. Osmakov DI, Kalinovskii AP, Belozerova

OA, Andreev YA, Kozlov SA. Lignans as

pharmacological agents in disorders rela-

ted to oxidative stress and inflammation:

Chemical Synthesis Approaches and Bio-

logical Activities. Int J Mol Sci 2022;23.

https://doi.org/10.3390/ijms23116031

31. Karuna R, Reddy SS, Baskar R, Saralaku-

mari D. Antioxidant potential of aqueous

extract of Phyllanthus amarus in rats. In-

dian J Pharmacol 2009;41:64-67. https://

doi.org/10.4103/0253-7613.51342

32. Kumar KB, Kuttan R. Chemoprotective

activity of an extract of Phyllanthus amarus

against cyclophosphamide induced toxici-

ty in mice. Phytomedicine 2005;12:494-

500. https://doi.org/10.1016/j.phymed.20

04.03.009

33. Cai W, Zhang Z, Huang Y, Sun H, Qiu

L. Vaccarin alleviates hypertension and

nephropathy in renovascular hypertensi-

ve rats. Exp Ther Med 2018;15:924-932.

https://doi.org/10.3892/etm.2017.5442

34. Borghi C, Omboni S. Angiotensin-con-

verting enzyme inhibition: beyond blood

pressure control-The role of Zofenopril.

Adv Ther 2020;37:4068-4085. https://doi.

org/10.1007/s12325-020-01455-2

35. Giani JF, Veiras LC, Shen JZY, Berns-

tein EA, Cao D, Okwan-Duodu D et

al. Novel roles of the renal angiotensin-

converting enzyme. Mol Cell Endocri-

nol 2021;529:111257. https://doi.org/

10.1016/j.mce.2021.111257

36. Dostal DE, Baker KM. The cardiac re-

nin-angiotensin system: conceptual, or

a regulator of cardiac function? Circ Res

1999;85:643-650. https://doi.org/10.116

1/01.res.85.7.643

37. Welch WJ. The pathophysiology of renin

release in renovascular hypertension. Se-

min Nephrol 2000;20:394-401.

38. Raveinal R. The effect of natural immuno-

modulator (Phyllanti herb extract) admi-

nistration on cellular immune response of

patients with pulmonary tuberculosis. Pa-

dang: University of Andalas 2003.

39. Amin Z. The effect of Phyllanthus extract

as an additional treatment in tuberculosis

patients with minimal and moderately ad-

vanced radiological lesion. Diss, University

of Indonesia, Jakarta 2005.

40. Halim H, Saleh K. The effectiveness of

Phyllanthus niruri extract in the manage-

ment of pulmonary tuberculosis. Dexa Me-

dia 2005;18:103-107.

41. Pramayanti I, Paraton H, Ma’at S. Compa-

rison of success rate of vaginal candidiasis

treatment between ketokonazole and com-

bination of ketokonazole-Phyllanthus niru-

ri extract. Dexa Media 2005;18:97-102.

42. Nishiura JL, Campos AH, Boim MA, Heil-

berg IP, Schor N. Phyllanthus niruri nor-

malizes elevated urinary calcium levels

in calcium stone forming (CSF) patients.

Urol Res 2004;32:362-366. https://doi.

org/10.1007/s00240-004-0432-8

43. Micali S, Sighinolfi MC, Celia A, De Ste-

fani S, Grande M, Cicero A et al. Can Phy-

llanthus niruri affect the efficacy of extra-

corporeal shock wave lithotripsy for renal

stones? A randomized, prospective, long-

term study. J Urol 2006;176:1020-1022.

44. Narendranathan M, Remla A, Mini PC,

Satheesh P. A trial of Phyllanthus amarus

in acute viral hepatitis. Trop Gastroenterol

1999;20:164-166.

45. Thyagarajan SP, Subramanian S, Thiru-

nalasundari T, Venkateswaran PS, Blum-

berg BS. Effect of Phyllanthus amarus on

chronic carriers of hepatitis B virus. Lancet

1988;2:764-766. https://doi.org/10.1016/

s0140-6736(88)92416-6