Invest Clin 65(2): 143 - 154, 2024 https://doi.org/10.54817/IC.v65n2a02

Corresponding author: ChuanYong Yu, Department of Neurology, Nanjing Brian Hospital affiliated to Nanjing

Medical Univerisity, Nanjing, Jiang Su Province, China; Tel: +86-13951898478. E-mail: yuchuanyongsub@yeah.net

Beneficial effects of gentiopicrin inhibiting

experimental epilepsy in young rats through

the P2X7R/NLRP3/Caspase-1 inflammatory

pathway.

Jia Lin Li

, Lin Huang

Xing Jun Wu

Min Ye

and Chuan Yong Yu

Department of Medicine, Tongling Polytechnic. Tongling, China.

Department of Neurology, Nanjing Brian Hospital affiliated to Nanjing Medical

University, Nanjing, China.

Department of Neurology, the Affiliated BenQ Hospital of Nanjing Medical University,

Nanjing, China.

Keywords: malondialdehyde; superoxide dismutase; apoptosis-associated speck-like

protein; Tunel positive cells; gentiopicroside; hippocampal CA3 region.

Abstract. This study mainly examined the protective effect of gentiopicrin

on on experimental epileptic young rats. Seventy-two Sprague Dawley (SD) rats

were used in this study. Twelve rats were randomly selected as the normal group,

and the remaining 60 rats were injected with lithium chloride-pilocarpine intra-

peritoneally to establish an epileptic model, and were randomly divided into five

groups of 12 rats each. The positive control group was given topiramate 5.9 mg/

kg in normal saline, and the low, middle, and high dose groups were given gen-

tiopicrin liquid, with the mass of gentiopicroside being 1.28 g/kg, 2.56 g/kg, and

5.12 g/kg respectively. The model and normal groups were given the same dose of

normal saline daily for four weeks. Compared with the model group, the damage

of neurons in the CA3 area of the hippocampus in the positive control group, low,

medium, and high dose groups of gentiopicrine was reduced. The number of Tunel

positive cells, malondialdehyde (MDA), P2X7R, NLRP3, ASC, Caspase-1 protein,

and mRNA in the model group were significantly higher than those in the control

group and superoxide dismutase (SOD) activity was significantly lower than that

in the control group (p<0.05). The number of Tunel positive cells, MDA content,

P2X7R, NLRP3, ASC, Caspase-1 protein, and mRNA in the positive control group,

low, medium, and high dosage groups of gentiopicroside were significantly lower

than those in the model group, and the SOD activity was significantly higher than

that in the model group (p<0.05). Gentiopicroside may improve the behavior of

young epileptic rats.

144 Li et al.

Investigación Clínica 65(2): 2024

Efectos inhibitorios de la gentiopicrina sobre la epilepsia

experimental en ratas jóvenes mediante la vía inflamatoria

P2X7R/NLRP3/Caspasa-1.

Invest Clin 2024; 65 (2): 143 – 154

Palabras clave: malondialdehído; superóxido dismutasa; proteína tipo punto asociada

a la apoptosis; células Tunel positivas; gentiopicrósido; región CA3 del

hipocampo.

Resumen. Este estudio examinó principalmente el efecto protector del gen-

tiopicrina en ratas jóvenes epilépticas. En este estudio se utilizaron setenta y

dos ratas Sprague Dawley (SD). Se seleccionaron al azar doce ratas como grupo

normal y a las 60 ratas restantes se les inyectó cloruro de litio-pilocarpina por

vía intraperitoneal para establecer un modelo epiléptico y se dividieron aleato-

riamente en cinco grupos de 12 animales cada uno. El grupo de control positivo

recibió 5,9 mg/kg de topiramato en solución salina normal, y los grupos de dosis

baja, media y alta recibieron gentiopicrina líquida, siendo la masa de gentiopicró-

sido 1,28 g/kg, 2,56 g/kg y 5,12 g/kg. kg respectivamente. Los grupos modelo y

normal recibieron la misma dosis de solución salina normal diariamente durante

cuatro semanas. En comparación con el grupo modelo, se redujo el daño de las

neuronas en el área CA3 del hipocampo en el grupo de control positivo y en los

grupos de dosis baja, media y alta de gentiopicrósido. El número de células Tu-

nel positivas, malondialdehído (MDA), P2X7R, NLRP3, ASC, proteína caspasa-1 y

ARNm en el grupo modelo fue significativamente mayor que en el grupo de con-

trol y la actividad de superóxido dismutasa (SOD) fue significativamente menor

que esa. en el grupo control (p<0,05). El número de células Tunel positivas, el

contenido de MDA, P2X7R, NLRP3, ASC, proteína caspasa-1 y ARNm en el grupo

de control positivo, los grupos de dosis baja, media y alta de gentiopicrósido fue-

ron significativamente menores que los del grupo modelo, y la actividad de SOD

fue significativamente mayor que la del grupo modelo (p<0,05). El gentiopicró-

sido puede mejorar el comportamiento de ratas epilépticas jóvenes.

Received: 13-05-2023 Accepted: 18-02-2024

INTRODUCTION

Epilepsy is a neurological disorder char-

acterized by sudden abnormal discharges of

neurons in the brain, causing transient dis-

ruptions in brain function. It can lead to neu-

ronal damage in regions such as the cerebral

cortex and hippocampus, and it is one of

the most common neurological disorders in

children

. Research shows that about 75% of

epilepsy patients develop the disease during

childhood

. The primary treatment method

for epilepsy is oral antiepileptic drugs. How-

ever, despite advances in the diagnosis and

treatment of epilepsy, long-term use of an-

tiepileptic drugs can lead to numerous ad-

verse reactions. Furthermore, about 30% of

children with epilepsy do not respond well to

treatment, and severe cases can result into

intractable epilepsy, which significantly af-

Effect of gentiopicrin on juvenile rats 145

Vol. 65(2): 143 - 154, 2024

fects the physical and mental health of pa-

tients

. Therefore, exploring the pathogen-

esis of epilepsy and finding new therapeutic

drugs and targets are crucial for the effec-

tive treatment of this disorder.

Research

indicates that during epilep-

tic seizures, the NLRP3 (nodlike receptor

protein 3) inflammasome is involved in cel-

lular pyroptosis through the classical Cas-

pase-1-dependent pathway, regulating the

expression of IL-1β and IL-18. The P2X7R

(purinergic ligand-gated ion channel 7 re-

ceptor), an ATP-gated cation non-selective

channel receptor, is a crucial contributor to

the formation and release of IL-1β and has

been widely considered an essential target

in brain tissue inflammatory responses

P2X7R is upregulated at different stages of

seizure In various models of epilepsy, includ-

ing the hippocampus, amygdala, piriform

cortex, and neocortex, and its activation can

induce and worsen inflammatory reactions

Multiple studies

7,8

have demonstrated that

in innate myeloid cells such as monocytes,

macrophages, and dendritic cells, the P2X7R

is the most effective activator of the NLRP3

inflammasome during the inflammatory pro-

cess. Current research

confirms that dur-

ing epileptic seizures, the P2X7R/NLRP3/

Caspase-1 pathway is significantly upregu-

lated, and downstream-specific inflamma-

tory factors such as IL-1β and IL-18 signifi-

cantly increase. These findings suggest that

the P2X7R/NLRP3/Caspase-1 pathway plays

a vital role in the development of epileptic

seizures.

Gentiopicrin, the primary active in-

gredient of Gentiana macrophylla, a plant

belonging to the Gentianaceae family, has

demonstrated pharmacological properties

such as anti-inflammatory, anti-oxidative

stress, and anti-apoptotic effects, making it

an effective natural medicine. Additionally,

it has been found to have low toxicity, high

safety, and multi-target synergistic effects

The study aims to induce status epilepticus

(SE) in juvenile rats through intraperitoneal

injection of lithium chloride-pilocarpine and

examine whether gentiopicrin can impact

the occurrence of epilepsy by regulating

the P2X7R/NLRP3/Caspase-1 inflamma-

tory pathway. The results of this study will

provide a foundation for gentiopicrin to be

considered as a potential candidate for the

effective treatment of childhood epilepsy.

MATERIALS AND METHODS

Experimental Animals

Seventy-two specified pathogen-free

male Sprague Dawley（SD） rats, aged 21

days and weighing 50-80g, were procured

from Beijing Vital River Laboratory Animal

Technology Co., Ltd. The production license

number is SCXK (JING) 2021-0011. The rats

were kept at the Central Animal Laboratory

of our institute under optimal conditions,

with a relative humidity of 70%, a tempera-

ture of 25°C, and a 12-hour light/dark cycle.

We strictly follow the 3R principle in the ex-

periment. The Animal Experiment Center of

Tongling Vocational and Technical College

Ethics Committee approved this study.

Reagents and Instruments

Main reagents: Tropisetron was pur-

chased from Xi’an Yangsen Pharmaceutical

Co., Ltd. Lithium chloride and pyrrolidine

carboxamide were purchased from Fluka,

USA. Gentiopicrin was purchased from Jing-

zhu Biotechnology Co., Ltd., and the Re-

verse transcription kit from Jiangsu Kang-

wei Century Biotechnology Co., Ltd. SYBR

Premix Ex Taq II was purchased from Takara,

Japan. BCA protein quantification kit and

protein marker were purchased from Bei-

jing Solarbio Science & Technology Co., Ltd.

P2X7R, NLRP3, ASC, and Caspase-1 primary

antibodies from Affinity, USA. Tunel staining

solution was purchased from Shanghai Biyun

Tian Biotechnology Co., Ltd.

Main instruments: A Micro 17R low-

temperature high-speed centrifuge was pur-

chased from Thermo, USA. CFX Connect

real-time fluorescence quantitative PCR in-

strument was purchased from BIORAD, USA.

146 Li et al.

Investigación Clínica 65(2): 2024

EPS300 electrophoresis apparatus, EPS300

electrophoresis tank, and VE186 transfer

apparatus were purchased from Zhejiang

Tianneng Corporation. 610020-9Q chemi-

luminescence analyzer was purchased from

Shanghai Qinxiong Scientific Instrument

Co., Ltd. RM2016 pathological slicer was

purchased from Shanghai Leica Instrument

Co., Ltd. Nikon Eclipse C1 upright fluores-

cence microscope and Nikon DS-U3 imaging

system were purchased from Nikon, Japan.

Animal grouping and model establishment

A total of 72 SD rats were used in the

study. Twelve rats were randomly assigned to

the normal group, while the remaining 60

rats were used to establish an epilepsy model.

The rats were first weighed and then injected

with 127 mg/kg of lithium chloride into the

abdominal cavity to induce epilepsy. After 20

hours, 1mg/kg of atropine sulfate was also

injected to reduce the peripheral cholinergic

reaction of pilocarpine. Thirty minutes later,

the rats were injected with 50mg/kg of pilo-

carpine. The success of the epilepsy model

was determined by using the Racine scoring

standard, which required a seizure frequency

of ≥4 and a duration of ≥30 minutes

. The

model construction is shown in Fig. 1.

The rats that were successfully mod-

eled were divided into groups randomly. The

positive control group received 5.9 mg/kg of

topiramate dissolved in 2 mL of normal sa-

line via gavage. The low-dose, medium-dose,

and high-dose groups were administered

gentiopicrin solution via gavage, dissolved in

2 mL of normal saline, at doses of 1.28g/kg,

2.56g/kg, and 5.12g/kg, respectively. The

model and normal groups were given the

same volume of saline via gavage once a day

for four weeks.

Behavioral assessment

Within two hours of administering pi-

locarpine, the rats were observed for any be-

havioral changes, and the onset latency and

duration of the first seizure were recorded.

The severity of SE in each group was graded

according to the Racine scoring system, as

follows: Stage 0, no seizures; Stage I, facial

twitching and mouth movements; Stage II,

frequent nodding or wet dog shakes; Stage

III, localized clonic seizures in the forelimbs;

Stage IV, generalized tonic-clonic seizures

with forelimb clonus and rigid posture in the

hindlimbs; and Stage V, generalized tonic-

clonic seizures with falling and rolling.

Tissue processing

After one, two, and seven days of mod-

eling, rats from each group were intraperi-

toneally injected with a 5% chloral hydrate

solution for anesthesia. Four rats from each

group were then quickly decapitated to ob-

tain brain tissue, rats were fixed on the op-

erating table, and their chests were opened

to expose the heart. The right auricle was

incised, and 150 mL of saline was perfused

to flush out the blood, followed by perfu-

sion with 150 mL of 4% paraformaldehyde

Fig. 1. Schematic diagram of epilepsy model construction.

Effect of gentiopicrin on juvenile rats 147

Vol. 65(2): 143 - 154, 2024

for fixation. The brain was quickly removed

after fixation and placed in a 4% paraformal-

dehyde solution for an additional 48 hours

of fixation before being subjected to Tunel

staining. The rest of the brain tissue was

stored at -80°C for subsequent analysis using

ELISA kits, Western blotting, and qRT-PCR.

Tunel staining to observe pathological

changes in hippocampal tissue

Brain tissue was fixed in 4% paraformal-

dehyde, and coronal brain sections contain-

ing the hippocampus, from 3 mm anterior

to 3 mm posterior to the optic chiasm, were

obtained. The sections were routinely dehy-

drated, transparentized, and embedded in

paraffin before being pre-cooled for section-

ing (thickness of 4 μm). The sections were

then deparaffinized with xylene, rehydrated

with gradient ethanol, and stained with Tu-

nel staining solution for 1-10 minutes. Af-

ter rinsing with distilled water twice for 15

seconds each, the sections were dehydrated

with 95% ethanol for 5 minutes, transparen-

tized with xylene for 5 minutes, and mount-

ed with neutral gum. Under a microscope,

the number of Tunel-positive stained cells in

each high-power field was counted, and the

average value was obtained.

ELISA detection of superoxide dismutase

(SOD) activity and malondialdehyde

(MDA) content in hippocampal tissue

Hippocampal tissue from rats obtained

on the 7th day after modeling was added to

pre-cooled PBS buffer, ground into a homo-

geneous slurry on ice, and centrifuged at

10,000 rpm for 10 minutes. The supernatant

was collected and divided into Eppendorf

(EP) tubes, then stored at -80°C. ① SOD ac-

tivity detection: 20μL of the test sample was

taken and sequentially added to the SOD de-

tection buffer, WST-8 working solution, and

reaction start working solution. The mixture

was incubated at 37°C for 30 minutes, and

the absorbance (A) value was measured at

450 nm wavelength. Using the formula inhi-

bition percentage = (ΔA blank - ΔA test) /

ΔA blank × 100%, the inhibition percentage

was calculated. The SOD enzyme activity (U/

mg) of the test sample was determined from

the standard curve. ② MDA content detec-

tion: 100μL of the test sample was taken and

sequentially added to the working solution,

distilled water, and test sample. The mixture

was incubated at 100°C in a water bath for

60 minutes, cooled in an ice bath, and cen-

trifuged at room temperature at 10,000g for

10 minutes. Next, 200 μL of the supernatant

was transferred to a glass cuvette, and the ab-

sorbance (A) values at 450 nm, 532 nm, and

600 nm were measured. The ΔA450 = A450

test - A450 blank, ΔA532 = A532 test - A532

blank, and ΔA600 = A600 test - A600 blank

were calculated. The MDA content (nmol/g)

was calculated as MDA content = 5 × [12.9

× (ΔA532 - ΔA600) - 2.58 × ΔA450].

Western blot analysis of P2X7R, NLRP3,

ASC, and Caspase-1 Protein expression

in hippocampal tissue

Hippocampal tissue was collected and

homogenized on ice on the seventh day after

modeling. The supernatant was obtained af-

ter centrifugation, and protein concentration

was measured using a BCA protein assay kit.

Protein lysates were separated on a 15% SDS-

PAGE gel with a 5% stacking gel, run at 80V

for two hours, and transferred to a membrane

at 60V for two hours. After blocking with

5% skim milk for two hours, the membrane

was incubated overnight at 4°C with rabbit

primary antibodies against P2X7R, NLRP3,

ASC, and Caspase-1 (diluted 1:1000). The fol-

lowing day, the membrane was washed with

TBST and incubated with a goat anti-rabbit

secondary antibody (diluted 1:2000) for two

hours at 37°C. After washing, the membrane

was incubated with a chemiluminescence re-

agent, and the protein expression levels were

quantified using ImageJ software with GAP-

DH as an internal reference protein. The rela-

tive protein expression levels were calculated

as the protein gray value of the target protein

divided by the protein gray value of the inter-

nal reference protein.

148 Li et al.

Investigación Clínica 65(2): 2024

qRT-PCR detection of hippocampal

P2X7R, NLRP3, ASC, and Caspase-1

mRNA expression

On the 7th day after modeling, hip-

pocampal tissue was obtained and ground

on ice. Total RNA was extracted using 1

mL of Trizol lysis buffer. The RevertAidTM

First Strand cDNA Synthesis Kit synthe-

sized cDNA as the fluorescent quantification

template. Takara designed and synthesized

Primers in Japan, and GAPDH was used as

the internal reference for all samples. The

reaction system included 0.5%μL dNTPs,

5μL 5×Buffer, 0.3 μL Taq enzyme, 21.5 μL

MgCl, 2 μL cDNA template, and 1 µL of up-

stream and downstream primers. Deionized

water was added to a total volume of 25µL.

The reaction conditions were as follows: pre-

denaturation at 95°C for 5 minutes, dena-

turation at 95°C for 30 seconds, annealing

at 62°C for 30 seconds, extension at 72°C

for 30 seconds, repeated for 40 cycles, and

final extension at 72°C for 10 minutes. The

reaction was terminated at 4°C for 5 min-

utes, and the experiment was repeated three

times. The relative expression level of the

target gene mRNA was calculated using the

-△△CT

method. Primer sequences are shown

in Table 1.

Table 1

Primer Sequences.

Gene Sequence

P2X7R Forward

GGACGAGCTACCCTTCGGT

Reverse

CTGTCTCACCCCCAGCATAG

NLRP3 Forward CACATCATGAAGGAGGAGG

Reverse

GCTATCACACAGCCTGGGTC

ASC Forward

ACCCTAATGCCTTGTTCCCA

Reverse

TGGGGAAGTCTTCAGCAAC

Caspase-1 Forward

GGCAGACCTATTTTGCACGA

Reverse

TAGCTGTCGATGGATGCCTC

U6 Forward CTGATGAAATACGCCCAGGT

Reverse

CTGTGGTTCTGGTTCGCTTT

Statistical Analysis

The experimental data were analyzed

using SPSS 26.0 software, and GraphPad 8.0

was utilized for plotting. Data that followed

a normal distribution, such as pathological

changes and protein expression level in each

sample group, were presented as mean ±

standard deviation (±SD). One-way analysis

of variance (ANOVA) was employed for com-

parisons among multiple groups, and t-tests

were used for pairwise comparisons. A p of

less than 0.05 was considered statistically

significant.

RESULTS

Effects of Gentiopicrin on behavioral

performance in juvenile rats with epilepsy

In the blank control group, the behav-

ior of the rats was normal, and no epileptic

seizures were observed, indicating a grade

0 level of epileptic seizures. In the positive

control group and gentiopicrin low, medium,

and high dose groups, the latency period

was significantly increased compared to the

model group. Moreover, the duration and se-

verity of epileptic seizures were significantly

reduced in the groups mentioned above com-

pared to the model group (p<0.05) (Fig. 2).

Effects of Gentiopicrin on Tunel staining

positive cell numbers in hippocampal

tissue

Tunel staining revealed that in the nor-

mal group, neurons in the CA3 region of rat

hippocampus were evenly distributed across

multiple layers, with pyramidal and granular

cells showing normal morphology, uniform

staining, tight arrangement, and round or

oval cell bodies with distinct nucleoli. The

cytoplasm of these cells had abundant Tunel

bodies, and occasional nuclear condensation

was observed. In contrast, compared to the

normal group, the model group showed a

reduction in the number and shape of neu-

rons in the CA3 region, with decreased cell

bodies, ruptures, nuclear condensation, and

a significant decrease in Tunel bodies in the

Effect of gentiopicrin on juvenile rats 149

Vol. 65(2): 143 - 154, 2024

cytoplasm. Compared to the model group,

the positive control group and gentiopicrin

low, medium, and high dose groups showed a

reduction in the degree of neuronal damage

in the CA3 region of the rat hippocampus.

The number of Tunel-stained positive cells

in the model group was significantly higher

than in the control group (p<0.05). Howev-

er, the number of Tunel-stained positive cells

in the positive control group and gentiopic-

rin low, medium, and high dose groups was

significantly lower than that in the model

group, and the differences were statistically

significant (p<0.05)(Fig. 3).

Effects of Gentiopicrin on superoxide

dismutase (SOD) activity and

malonilaldehyde (MDA) content

in hippocampal tissue

In the model group, the SOD activity

was significantly lower, and the MDA con-

tent was significantly higher than that in the

control group, with statistical significance

(p<0.05). However, in the positive control

group and gentiopicrin low, medium, and

high dose groups, the SOD activity was sig-

nificantly higher, while the MDA content

was significantly lower than that in the

model group, with statistical significance

(p<0.05), (Fig. 4).

Effects of Gentiopicrin on the expression

of P2X7R, NLRP3, ASC, Caspase-1

proteins, and mRNA in hippocampal

tissue

The expression levels of P2X7R, NLRP3,

ASC, Caspase-1 proteins, and mRNA in the

model group were significantly higher than

those in the control group, with statistical

significance (p<0.05). However, in the posi-

tive control group and gentiopicrin low, me-

dium, and high dose groups, the expression

levels of P2X7R, NLRP3, ASC, Caspase-1

proteins, and mRNA were significantly low-

er than those in the model group, with sta-

tistical significance (p<0.05), (Fig. 5).

Fig. 2. Effect of gentiopicroside on epileptic behavior in young rats (*compared with Normal group, p<0.05,

# compared with Model group, p<0.05).

Fig. 3. Comparison of Tunel staining results in each

group (*compared with Normal group p<0.05,

# compared with Model group p<0.05).

150 Li et al.

Investigación Clínica 65(2): 2024

Fig. 5. Effects of gentiopicroside on P2X7R, NLRP3,

ASC, Caspase-1 protein and mRNA in hip-

pocampus (*compared with Normal group,

p<0.05, #compared with Model group, p

<0.05).

Gentiopicrin improves behavioral

performance in juvenile rats with

epilepsy by regulating the P2X7R/

NLRP3/Caspase-1 pathway to inhibit

inflammatory factor expression.

Gentiopicrin significantly prolonged

the latency period of epileptic rats, reduced

the duration and severity of seizures, impro-

ved hippocampal tissue pathology, increased

hippocampal tissue SOD activity, and de-

creased MDA levels. Furthermore, it down-

regulated critical proteins in the P2X7R/

NLRP3/Caspase-1 pathway. Therefore, we

speculate that gentiopicrin may improve

behavioral performance in epileptic rats by

regulating the P2X7R/NLRP3/Caspase-1

pathway to inhibit inflammatory factor ex-

pression. A schematic diagram of the mecha-

nism is shown in Fig. 6.

DISCUSSION

Epilepsy is a common and severe neu-

rological disorder that can cause recurrent,

transient, and paroxysmal seizures, resulting

in high mortality and disability rates, parti-

cularly among children. This condition signi-

ficantly affects the quality of life of patients

. At present, the primary clinical approach

for treating epilepsy is through the use of

antiepileptic drugs (AEDs). However, AEDs

only provide partial and incomplete control

Fig. 4. Effect of gentiopicroside on SOD activity and MDA content in the hippocampus (*compared with

Normal group, p <0.05, # compared with Model group, p<0.05).

SOD: superoxide dismutase; MDA: malonilaldehyde.

Effect of gentiopicrin on juvenile rats 151

Vol. 65(2): 143 - 154, 2024

of seizures in approximately 30% of epilepsy

patients

. Moreover, long-term use of AEDs

can lead to significant adverse reactions,

such as cognitive impairment, psychiatric

side effects, teratogenic effects, and toxic

effects on the liver. Therefore, it is of utmost

importance to identify new drug targets and

develop new antiepileptic drugs for children.

Gentiopicrin is a natural bicyclic diterpe-

noid lactone compound with various biologi-

cal activities, mainly extracted from Gentia-

na macrophylla, a characteristic medicinal

plant in Ningxia, China

. Previous studies

have shown that gentiopicrin can help alle-

viate anxiety and depression symptoms, me-

mory impairment, and nerve damage.

The P2X7 receptor can affect the relea-

se of downstream inflammatory factors and

the activation of immune cells by influen-

cing various signaling pathways, such as the

P-38MAPK, NF-ΚB, and NLRP3/Caspase-1

pathways

. Recent studies have confirmed

that the P2X7R/NLRP3/Caspase-1 pathway

is significantly upregulated during seizures,

leading to increased expression of specific

inflammatory factors like IL-1β and IL-18

This suggests that the P2X7R/NLRP3/Cas-

pase-1 pathway is a critical mediator in sei-

zure activity

. In this study, we focused on

the protective effect of gentiopicrin on neu-

rons in a rat model of epilepsy by targeting

the P2X7R/NLRP3/Caspase-1 pathway. We

induced SE in rats using lithium chloride-

pilocarpine and used topiramate as the po-

sitive control drug. The results showed that

the gentiopicrin intervention significantly

prolonged the SE latent period, shortened

seizure duration, and reduced SE in a dose-

dependent manner, indicating its antiepilep-

tic effects in SE rats. Seizures can lead to

decreased brain nerve cells, neuronal dama-

ge, and cell apoptosis, directly affecting the

patient’s prognosis and condition develop-

ment

. In this study, the protective effect

of gentiopicrin on hippocampal damage in

epileptic rats was observed through Tunel

staining. Pathological section staining re-

vealed that hippocampal neurons in the

model group exhibited significant damage,

with disordered arrangement, small or rup-

tured cell bodies, condensed nuclei, redu-

ced Tunel bodies in the cytoplasm, and an

increased number of damaged cells over

time. Compared with the model group, the

number of damaged neurons in the CA3

region of the hippocampus in the positive

control and gentiopicrin low, medium, and

high dose groups decreased, the degree of

damage was reduced, and the number of da-

maged cells did not increase over time. The-

se results suggest that gentiopicrin has an

inhibitory effect on hippocampal neuronal

Fig. 6. Mechanism diagram of gentiopicroside improving the behavior of epileptic young rats by regulating

P2X7R/NLRP3/Caspase-1 to inhibit the expression of inflammatory factors.

152 Li et al.

Investigación Clínica 65(2): 2024

damage caused by epilepsy. Oxidative stress-

induced brain cell damage and weakened an-

tioxidant capacity are essential mechanisms

underlying the occurrence and persistence

of epilepsy and other neurological diseases

. SOD, an important antioxidant enzyme,

reflects the body’s ability to remove free ra-

dicals, while MDA is related to the degree

of tissue cell damage and is a lipid peroxide

produced after tissue cells are damaged by

oxygen free radicals

. The findings of this

study showed that epilepsy can increase the

MDA content in hippocampal tissue and re-

duce SOD activity, whereas gentiopicrin can

inhibit oxidative stress-induced damage cau-

sed by epilepsy, increase SOD activity, and

reduce MDA production.

The NLRP3 inflammasome is a com-

plex composed of three essential proteins:

the NOD-like receptor NLRP3, the adapter

protein ASC, and the effector protein Cas-

pase-1

. Once activated, NLRP3 releases

Caspase-1, which in turn cleaves precursor

forms of IL-1β and IL-18, generating mature

and activated forms of these cytokines that

promote the development of inflammation

.The P2X7R receptor is a crucial factor in

activating the NLRP3 inflammasome. When

neural tissue is damaged, a large amount of

ATP is released, which binds to the P2X7 re-

ceptor on microglia and promotes the for-

mation of the NLRP3 inflammasome. This

results in the acceleration of maturation and

release of inflammatory factors such as IL-

1β and IL-18, initiating a cascade effect

24-26

The study results show that both the protein

and mRNA levels of P2X7R, NLRP3, ASC,

and Caspase-1 were significantly higher in

the model group than in the control group.

However, in the positive control group and

the low, medium, and high dose groups of

gentiopicrin, the protein and mRNA levels

of P2X7R, NLRP3, ASC, and Caspase-1 were

significantly lower than those in the model

group. Yang Wenwei and other scholars have

also found that gentiopicroside inactivates

NLRP3 inflammatory corpuscles by inhibi-

ting P2X7R expression, thus reducing the

occurrence of epilepsy in young rats

, which

is similar to the results of this study.

In conclusion, the results of this stu-

dy suggest that gentiopicrin may improve

behavioral deficits in epileptic rats by regu-

lating the expression of inflammatory fac-

tors through the P2X7R/NLRP3/Caspase-1

pathway.

Funding

None.

Conflicts of interest

The authors declare no conflicts of in-

terest to report regarding the present study.

The authors declare that they have no

competing interests.

ORCID numbers

• JiaLin Li (JLL):

0009-0008-7613-3439

• Lin Huang (LH):

0009-0000-3220-9157

• XingJun Wu (XJW):

0009-0001-3390-5493

• MinYe (MY):

0009-0002-9862-3427

• ChuanYong Yu (CYY):

0009-0005-0969-6547

REFERENCES

1. Gong X, Liu L, Li X, Xiong J, Xu J, Mao

D, Liu L. Neuroprotection of cannabidiol

in epileptic rats: Gut microbiome and me

tabolome sequencing. Front Nutr. 2022;

9:1028459.

2. Desai D, Shende P. β-Cyclodextrin-

crosslinked synthetic neuropeptide Y-

based nanosponges in epilepsy by contri

buting GABAergic signal. Nanomedicine:

NBM.2022; 45:102594.

3. Colangeli R, Morena M, Werner A,

Thompson R J, van der Stelt M, Pittman

QJ, Hill MN, Teskey GC. 2-AG-mediated

Effect of gentiopicrin on juvenile rats 153

Vol. 65(2): 143 - 154, 2024

control of GABAergic signaling is impaired

in a model of epilepsy. J Neurosci.2023;

43:571-583.

4. Qin Z, Song J, Lin A, Yang W, Zhang W,

Zhong F, Huang L, Lü Y, Yu W. GPR120

modulates epileptic seizure and neuroin

flammation mediated by NLRP3 inflam-

masome. J Neuroinflamm. 2022; 19:121.

5. Guerra Leal B, Barros-Barbosa A, Ferrei

rinha F, Chaves J, Rangel R, Santos A,

Carvalho C, Martins-Ferreira R, Samões

R, Freitas J, Lopes J, Ramalheira J, Lobo

MG, Martins da Silva A, Costa PP, Co

rreia-de-Sá P. Mesial Temporal Lobe Epi-

lepsy (MTLE) Drug-refractoriness is asso-

ciated with P2X7 receptors overexpression

in the human hippocampus and temporal

neocortex and may be predicted by low cir

culating levels of miR-22. Front Cell Neu-

rosci. 2022; 16:910662.

6. Engel T. The P2X7 Receptor as a mecha

nistic biomarker for epilepsy. Int J Mol Sci.

2023;24:5410.

7. Wang Y, Shan Z, Zhang L, Fan S, Zhou

Y, Hu L, Wang Y, Li W, Xiao Z. P2X7R/

NLRP3 signaling pathway-mediated pyrop

tosis and neuroinflammation contributed

to cognitive impairment in a mouse model

of migraine. J Headache Pain.2022;23:75.

8. Liu C, She Y, Huang J, Liu Y, Li W, Zhang

C, Zhang T, Yu L. HMGB1-NLRP3-P2X7R

pathway participates in PM(2.5)-induced

hippocampal neuron impairment by regu

lating microglia activation. Ecotoxicol En-

viron Saf. 2022;239:113664.

9. Pohlentz MS, Müller P, Cases-Cunillera S,

Opitz T, Surges R, Hamed M, Vatter H,

Schoch S, Becker AJ, Pitsch J. Charac

terisation of NLRP3 pathway-related neu-

roinflammation in temporal lobe epilepsy.

PloS one.2022;17:e0271995.

10. Ren G, Zhang Q, Xia P, Wang J, Fang P, Jin

X, Peng X, Xu Y, Zhang J, Zhao L. Synthe

sis and biological evaluation of gentiopi-

croside derivatives as novel cyclooxyge-

nase-2 inhibitors with anti-inflammatory

activity. Drug Des Dev Ther.2023;17:919-

935.

11. Wu L, Qin Y, Yuan H, Zhu Y, Hu A. Anti-

inflammatory and neuroprotective effects

of insulin-like growth factor-1 overexpres

sion in pentylenetetrazole (PTZ)-induced

mouse model of chronic epilepsy. Brain

Res. 2023;15:1785.

12. Piper RJ, Richardson RM, Worrell G,

Carmichael DW, Baldeweg T, Litt B, De

nison T, Tisdall MM. Towards network-gui-

ded neuromodulation for epilepsy. Brain

2022;145:3347-3362.

13. Belete D, Jacobs BM, Simonet C, Best

wick JP, Waters S, Marshall CR, Dobson

R, Noyce AJ. Association between antiepi

leptic drugs and incident Parkinson disea-

se. JAMA Neurol 2023;80:216.

14. Zhang L, Ulriksen ES, Hoel H, Sandvik

L, Malterud KE, Inngjerdingen KT, Inn

gjerdingen M, Wangensteen H. Phyto-

chemical characterization and anti-in-

flammatory activity of a water extract of

Gentiana purpurea roots. J Ethnopharma

col. 2023;301:115818.

15. Wang Y, Sheng Y, Ji N, Zhang H. Gentio

picroside enhances the protective effect

of trimetazidine against myocardial is

chemia-reperfusion injury via the AMPK/

NLRP3 inflammasome signaling. J Bio

chem Mol Toxic.2023;37:e23366

16. Sun S, Jiang W, Yan X, Zhang J, Gao L, Wu

C, Zhu B, Wu L. Ligand-gated ion channel

P2X7 regulates NLRP3/Caspase-1-media

ted inflammatory pain caused by pulpitis

in the trigeminal ganglion and medullary

dorsal horn. Brain Res Bull.2023;192:1-10.

17. Fu Z, Lin Q, Xu Z, Fu W, Shi D, Cheng

Y, Yang T, Liu G, Shi H, Cheng D. Lon

gitudinal positron emission tomography

imaging with P2X7 receptor-specific radio

ligand 18F-FTTM in a kainic acid rat model

of temporal lobe epilepsy. ACS Chem Neu

rosci. 2022;13:3512-3522.

18. Tashakori-Miyanroudi M, Ramazi S, Has

hemi P, Nazari-Serenjeh M, Baluchnejad-

mojarad T, Roghani M. Acetyl-L-carnitine

exerts neuroprotective and anticonvul

sant effect in kainate murine model of

temporal lobe epilepsy. J Mol Neuros

ci.2023;72:1224-1233.

19. Zhou Y, Su Y, Li S, Kennedy BC, Zhang

DY, Bond AM, Sun Y, Jacob F, Lu L, Hu P,

Viaene AN, Helbig I, Kessler SK, Lucas T,

154 Li et al.

Investigación Clínica 65(2): 2024

Salinas RD, Gu X, Chen HI, Wu H, Klein-

man JE, Hyde TM, Nauen DW, Weinberger

D R, Ming GL, Song H. Molecular landsca

pes of human hippocampal immature neu-

rons across lifespan. Nature 2022;607:527-

533.

20. Alyami NM, Abdi S, Alyami HM, Almeer

R. Proanthocyanidins alleviate pentyle

netetrazole-induced epileptic seizures in

mice via the antioxidant activity. Neuro

chem Res 2022;47:3012-3023.

21. Wang Z, Na Z, Cui Y, Wei C, Wang S. Ln

cRNA ZFAS1 regulates the hippocampal

neurons injury in epilepsy through the

miR-15a-5p/OXSR1/NF-κB pathway. Me

tab Brain Dis 2022;37:2277-2290.

22. Arab HH, Abd El Aal HA, Alsufyani SE,

El-Sheikh AAK, Arafa EA, Ashour AM, Ka

bel AM, Eid AH. Topiramate reprofiling for

the attenuation of cadmium-induced tes

ticular impairment in rats: role of NLRP3

inflammasome and AMPK/mTOR-linked

autophagy. Pharma 2023;15:1402.

23. Pohlentz MS, Müller P, Cases-Cunillera S,

Opitz T, Surges R, Hamed M, Vatter H,

Schoch S, Becker AJ, Pitsch J. Charac

terisation of NLRP3 pathway-related neu-

roinflammation in temporal lobe epilepsy.

Plos One 2023;17:e0271995.

24. Luo L, Liu M, Fan Y, Zhang J, Liu L, Li

Y, Zhang Q, Xie H, Jiang C, Wu J, Xiao

X, Wu Y. Intermittent theta-burst stimula

tion improves motor function by inhibiting

neuronal pyroptosis and regulating micro

glial polarization via TLR4/NFκB/NLRP3

signaling pathway in cerebral ischemic

mice. J Neuroinflamm 2022;19:141.

25. Jung ES, Suh K, Han J, Kim H, Kang

HS, Choi WS, Mook-Jung I. Amyloid-β

activates NLRP3 inflammasomes by

affecting microglial immunometabolism

through the Syk-AMPK pathway. Aging cell

2023;21:e13623.

26. Vezzani A, Friedman A, Dingledine RJ.

The role of inflammation in epileptogene

sis. Neuropharmacology. 2013;69:16-24.

27. Yang W, Ma L, Xu S, Zheng P, Du J, Wu

J, Yu J, Sun T. Gentiopicroside alleviated

epileptogenesis in immature rats through

inactivation of NLRP3 inflammasome by

inhibiting P2X7R expression. Int J Dev

Neurosci 2023;83(1):53-66.