Invest Clin 62(4): 295 - 306, 2021 https://doi.org/10.22209/IC.v62n4a01

Corresponding author: Yong Tang. Department of Cardiology, Affiliated Nanjing Hospital of Nanjing University of

Chinese Medicine, Nanjing, China. Email: tangyong86@126.com

Thymosin β4 regulates endothelial cell

function via activating the AKT pathway.

Yong Tang1, Hao Dong1, Wenbin Lu2, Xiaofeng Zhang1, Xiao Shen1 and Peizhe Zhang1

1Department of Cardiology, Affiliated Nanjing Hospital of Nanjing University

of Chinese Medicine, Nanjing, China.

2Department of Cardiology, Zhongda Hospital Affiliated to Southeast University,

Zhongda, China.

Key words: thymosin β4; HUVECs; proliferation; migration; apoptosis; AKT signaling.

Abstract. The vascular eendothelial cells are highly heterogeneous and

associated with numerous diseases. Thymosin β4 (Tβ4) plays pleiotropic roles

in endothelial cell differentiation, migration and angiogenesis. However, the

underlying mechanisms played by Tβ4 in the regulation of endothelial cells

have not yet been well investigated. In the present study, Tβ4 -GFP adenovirus,

transfected into human umbilical vein endothelial cells (HUVECs), and cell

morphology were analyzed by fluorescence microscopy. ELISA was used to de-

termine the concentration of Tβ4 expression. Furthermore, the effects of Tβ4

overexpression on HUVECs proliferation, apoptosis and migration were investi-

gated. Real-time quantitative PCR and western blot were conducted to examine

mRNA and protein expression in HUVECs with Tβ4 overexpression. Moreover,

the underlying molecular mechanism of Tβ4 in HUVECs function was tested

through treatment with LY294002, a PI3K/AKT inhibitor. Overexpression of

Tβ4 increased the cell ability of HUVECs, and up-regulated the expression of

the proliferation markers PCNA and Cyclin D1. In addition, overexpression of

Tβ4 reduced HUVECs apoptosis, both under normoxic and hypoxic conditions.

Moreover, overexpression of Tβ4 increased the ability of HUVECs to migrate

through the membrane and up-regulated levels of MMP-2 and MMP-9. The use of

LY294002 decreased the p-AKT (Ser473) level, which was induced by Tβ4 over-

expression. Importantly, LY294002 reduced Tβ4-induced HUVECs proliferation

and migration. In conclusion, our results suggest that Tβ4 is a major regulator

of HUVECs function by activating the AKT signaling pathway.

296 Tang et al.

Investigación Clínica 62(4): 2021

La timosina β4 regula la función de las células endoteliales,

activando la vía AKT.

Invest Clin 2021; 62 (4): 295-306

Palabras clave: timosina β4; HUVEC; proliferación; migración; apoptosis; señalización

de AKT.

Resumen. Las células endoteliales vasculares son muy heterogéneas y es-

tán asociadas con numerosas enfermedades. La Tβ4 desempeña papeles pleio-

trópicos en la diferenciación, migración y angiogénesis de células endoteliales.

Sin embargo, los mecanismos fundamentales que realiza la Tβ4 en la regulación

de las células endoteliales aún no han sido bien investigados. En el presente es-

tudio se analizaron el adenovirus Tβ4 –GFP transfectado en las células endote-

liales de vena umbilical humana (HUVEC) y la morfología celular, mediante mi-

croscopía de fluorescencia. ELISA se utilizó para determinar la concentración

de la expresión de Tβ4. También, se investigaron los efectos de la sobrexpresión

de la Tβ4, sobre la proliferación de las HUVEC, la apoptosis y la migración. Se

realizaron la PCR cuantitativa en tiempo real y el Western blot para examinar

el mRNA y la expresión de proteínas en las HUVEC con sobreexpresión de Tβ4.

Además, se probó el mecanismo molecular subyacente de Tβ4 sobre la función

de las HUVEC mediante el tratamiento con LY294002, un inhibidor de la PI3K/

AKT. La sobreexpresión de Tβ4 aumentó la capacidad celular de las HUVEC, re-

gulando al alza la expresión de los marcadores de proliferación PCNA y Ciclina

D1. Además, la sobreexpresión de Tβ4 redujo la apoptosis de las HUVEC, tanto

en condiciones normóxicas como hipóxicas. Por otra parte, la sobreexpresión

de Tβ4 aumentó la capacidad de las HUVEC a migrar a través de la membrana

y reguló hacia arriba los niveles de MMP-2 y MMP-9. El uso del LY294002 dis-

minuyó el nivel de p-AKT (Ser473), que fue inducido por la sobreexpresión de

Tβ4. Es importante destacar que LY294002 bajó la proliferación y la migración

de las HUVEC inducidas por Tβ4. En conclusión, nuestros resultados sugieren

que Tβ4 es un regulador principal de la función de las HUVEC mediante la acti-

vación de la vía de señalización de AKT.

Received: 06-04-2021 Accepted: 30-05-2021

INTRODUCTION

The vascular endothelial cells are highly

heterogeneous and associated with numer-

ous diseases, such as atherosclerosis (1).

Atherosclerosis causes stroke and coronary

heart disease (2), aging induced cardiovas-

cular disease (3), diabetes mellitus (4), vas-

cular injuries induced by limb ischemia and

reperfusion (5), etc. However, the underly-

ing mechanism of endothelial cell prolifera-

tion, apoptosis and migration has not been

fully elucidated.

Thymosin beta 4 (Tβ4) was first isolated

from calf thymus and it is a highly conserved

G-actin-sequestering peptide (6). It has been

Thymosin β4 regulates endothelial cell function through AKT pathway 297

Vol. 62(4): 295 - 306, 2021

reported that Tβ4 is expressed in various cell

types, such as endothelial cells, and plays

pleiotropic roles in endothelial cell differen-

tiation, migration, and angiogenesis (7-9).

Smart et al. (10) found that Tβ4 knockdown

reduced the coronary vasculogenesis and an-

giogenesis by a significant reduction in the

pro-angiogenic cleavage product N-acetyl-

seryl-aspartyl-lysyl-proline (AcSDKP) in mice

heart. Tβ4, which was secreted from the

myocardium, promoted epicardium-derived

cells inward migration and differentiation

into endothelial cells, and further to form

the coronary vasculature (11). Tβ4 could

activate mast cells to produce angiogenesis

associated factors, such as VEGF, and stimu-

late endothelial cell migration and differen-

tiation (12). Although the pieces of evidence

mentioned above demonstrated beneﬁcial

roles of Tβ4 for cardiac disease treatment by

regulating endothelial cell function, the un-

derlying mechanisms played by Tβ4 have not

yet been well considered. In this study, we

aimed to investigate the role of Tβ4 in the

regulation of HUVECs proliferation, apopto-

sis, and migration through the AKT signal-

ing pathway.

MATERIALS AND METHODS

Cell culture

Human HUVECs were obtained from

Nanjing KeyGen Biotech Co. Ltd. (Nanjing,

China) and cultured in RPMI-1640 (Gibco,

Grand Island, NY, USA) supplemented with

10% fetal bovine serum (FBS; Gibco, Grand

Island, NY, USA), streptomycin and penicillin

(Nanjing KeyGen Biotech Co. Ltd.) at 37°C

under a humidiﬁed 5% CO2 atmosphere.

The hypoxic condition was made in a sealed

chamber with a gas mixture containing 5%

CO2, 92% N2, and 3% O2.

Cell transfection

TB4-GFP adenovirus (Ad-Tβ4) and its

negative control (Ad-NC) were obtained

from GenePharma Co., Ltd. (Shanghai,

China). Logarithmic growth phase HUVECs

were seeded into 6-well plates (8×103 cells/

well) and then infected with Ad-Tβ4 or Ad-NC

at an MOI of 25. The efﬁciency of infection

was assessed by green fluorescence protein

(GFP), and expression of GFP in HUVECs

was confirmed by ﬂuorescence microscopy.

The enzyme-linked immunosorbent

assay (ELISA)

The concentration of Tβ4 in superna-

tant fluid of cultured HUVECs were analyzed

by a human Tβ4 ELISA kit (Jingkang Bio-

engineering Co., Ltd., Shanghai, China) ac-

cording to the manufacturer’s instructions.

Cell proliferation assay

To investigate the effect of Tβ4 up-reg-

ulation on HUVECs, an MTT assay was de-

signed. In brief, 5×104 HUVECs were seeded

into 96-well plates and were infected with

Ad-T β4 or Ad-NC for 24 h. Then 20 μL of 5

mg/mL [3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyl tetrazolium bromide (MTT)] (Am-

resco, Washington, USA) in PBS was added

and incubated at 37˚C for 4 h. Subsequently,

150 μL dimethylsulfoxide (DMSO; Sigma,

USA) was added to each well to dissolve the

formazan product. The absorbance was mea-

sured at 490 nm using a microplate reader

(Bio-Rad, Hercules, CA, USA).

Cell apoptosis assay

To explore the effect of Tβ4 on HUVECs

apoptosis, 1×106 HUVECs cells were collect-

ed, washed with PBS, and resuspended in 100

μL binding buffer, containing 5 μL Annexin V-

APC and 5 μL 7-AAD (BD Biosciences, Frank-

lin Lakes, NJ, USA) at room temperature.

Then, the cell apoptosis was tested using a

flow cytometer (BD FACSCalibur, BD Biosci-

ences, CA, USA). Four subpopulations were

divided in figure from flow-cytometric analy-

sis: normal cells (Annexin V-APC−/7-AAD−),

necrotic cells (Annexin V-APC−/7-AAD+),

early apoptotic (Annexin V-APC+/7-AAD−)

and late apoptotic (Annexin V-APC+/7-

AAD+). Apoptosis index was the total rates

of early apoptotic and late apoptotic cells.

298 Tang et al.

Investigación Clínica 62(4): 2021

Cell migration assay

For cell migration assay, the Transwell

cell culture chambers with 8-μm pore polycar-

bonate membrane filters (Millipore, Billerica,

MA, USA) were used. Approximately 5×105

HUVECs, which mixed in FBS-free RPMI-1640,

were seeded into the upper chamber, whereas

the lower chamber was filled with RPMI-1640

containing 5% FBS. After 24 h, non-migrated

cells from the upper chamber were removed;

and migrated cells to the bottom side of the

membrane were fixed with 90% alcohol and

stained with crystal violet. The migrated cells

were counted under a light microscope with

200-fold magnification.

RNA isolation and real-time quantitative

PCR

Total RNA from cultured HUVECs was

extracted using a miRNeasy kit (Qiagen,

Hilden, Germany) according to the manu-

facturer’s protocol. Total RNA (1 μg) was

reverse transcribed into cDNA by MuLV re-

verse transcriptase (NEB, USA). Real-time

quantitative PCR (RT-qPCR) analysis was

performed using Fast SYBR Green (Applied

Biosystems, Forster City, CA, USA). Details

of the specific RT-qPCR primers to deter-

mine relative levels of gene expression are

shown in Table I.

Western Blot

HUVECs were lysed with the RIPA ly-

sis buffer (Sigma, USA) according to the

manufacturer’s instruction. Equal protein

was separated by using the 10% sodium

dodecyl sulfate-polyacrylamide gel electro-

phoresis (SDS-PAGE) and transferred onto

a polyvinylidene difluoride (PVDF) mem-

brane (Millipore, MA, USA). The membranes

were blocked with 5% skim milk, and probed

overnight at 4°C using the following pri-

mary antibodies: anti-PCNA (Abcam, MA,

USA), anti-Cyclin D1 (Abcam, MA, USA),

anti-MMP-2 (Cell Signaling Technology, Bev-

erly, MA, USA), anti-MMP-9 (Cell Signaling

Technology, Beverly, MA, USA), anti-cleaved

caspase-3 (Abcam, MA, USA), anti-AKT (Cell

Signaling Technology, Beverly, MA, USA), an-

ti-p-AKT (Ser473) (Cell Signaling Technolo-

gy, Beverly, MA, USA), and GAPDH (Abcam,

MA, USA). Then, the membrane was incu-

bated with HRP-labelled secondary antibody

(Abcam, MA, USA) and visualized using an

enhanced chemiluminescence system (GE

Healthcare, Piscataway, NJ, USA).

Statistical analysis

The data in this study were analyzed by

Graphpad Prism 5.0 software and displayed

as mean ± standard deviation (SD). The Stu-

TABLE I

PRIMER SEQUENCES USED IN RT-qPCR EXPERIMENTS.

Gene name Primer sequence (5’ → 3’)

PCNA Forward: CCTGCTGGGATATTAGCTCCA

Reverse: CAGCGGTAGGTGTCGAAGC

Cyclin D1 Forward: GCTGCGAAGTGGAAACCATC

Reverse: CCTCCTTCTGCACACATTTGAA

MMP-2 Forward: TGACTTTCTTGGATCGGGTCG

Reverse: AAGCACCACATCAGATGACTG

MMP-9 Forward: TGTACCGCTATGGTTACACTCG

Reverse: GGCAGGGACAGTTGCTTCT

GAPDH Forward: GGAGCGAGATCCCTCCAAAAT

Reverse: GGCTGTTGTCATACTTCTCATGG

Thymosin β4 regulates endothelial cell function through AKT pathway 299

Vol. 62(4): 295 - 306, 2021

dent’s t-test was used to compare the means

between the two groups. A value of p<0.05

was considered to indicate a statistically sig-

nificant difference.

RESULTS

Tβ4 overexpression promotes HUVECs

proliferation

To explore the role of Tβ4 in the reg-

ulation of HUVECs function, we infected

HUVECs with Ad-Tβ4 or Ad-NC (Fig. 1A).

An ELISA analysis was conducted to verify

the transfection efficiency, and the results

showed that Ad-Tβ4 significantly elevated

Tβ4 expression in HUVECs (Fig. 1B).

The overexpression of Tβ4 significantly

promoted HUVECs growth (Fig. 2A). More-

over, RT-qPCR and western blot analysis indi-

cated that the mRNA and protein expression

of PCNA and Cyclin D1, which are cell pro-

liferation markers, significantly increased in

HUVECs infected with Ad-Tβ4 (Fig. 2B-D).

These data confirmed that Tβ4 promoted

the growth of HUVECs.

Tβ4 overexpression reduces HUVECs

apoptosis

To investigate whether Tβ4 could affect

HUVECs apoptosis, HUVECs were stained

with Annexin V, and followed by flow cytom-

etry. As shown in Fig. 3A, HUVECs infected

with Ad-Tβ4 showed less rate of cell apopto-

sis compared with cells infected with Ad-NC.

The level of cleaved caspase-3 in HUVECs

infected with Ad-Tβ4 was down-regulated

when compared with HUVECs infected with

Ad-NC (Fig. 3B). Also, the effect of Tβ4 on

HUVECs apoptosis under hypoxic conditions

was examined by flow cytometry. The apop-

tosis results showed that hypoxia significant-

ly increased the rate of HUVECs apoptosis,

whereas overexpression of Tβ4 decreased

HUVECs apoptosis after exposure to hypoxic

conditions (Fig. 3C). Moreover, overexpres-

sion of Tβ4 reduced the level of cleaved cas-

Fig.1. The level of Tβ4 was increased in HUVECs infected with Ad-Tβ4. (A) Morphology of HUVECs observed

under a fluorescence microscope upper panel, bright field, 200×; lower panel, fluorescence field,

200×). (B) Tβ4 concentration determined by ELISA. Data are presented as means ± S.D. from 3

independent experiments. *p<0.05.

300 Tang et al.

Investigación Clínica 62(4): 2021

pase-3 in HUVECs after exposure to hypoxic

conditions (Fig. 3D). Our data indicated that

Tβ4 could inhibit HUVECs apoptosis both

under normoxic and hypoxic conditions.

Tβ4 overexpression promotes HUVECs

migration

To demonstrate the role of Tβ4 in HU-

VECs migration, a Transwell migration assay

was conducted. As shown in Fig.4.A, overex-

pression of Tβ4 increased the ability of HU-

VECs to migrate through the membrane.

MMPs are the main proteolytic enzymes that

contribute to the degradation of the extra-

cellular matrix and serve critical roles in the

invasion process (13). RT-qPCR determined

that Tβ4 overexpression up-regulated the

mRNA and protein levels of MMP-2 and MMP-

Fig. 2. Tβ4 overexpression promoted HUVECs proliferation. (A) CCK-8 analysis of the cell proliferation in

HUVECs infected with Ad-NC or Ad-Tβ4. (B, C) The relative mRNA level of PCNA (B) and Cyclin D (C)

in HUVECs infected with Ad-NC or Ad-Tβ4. (D) The protein level of PCNA and Cyclin D in HUVECs

infected with Ad-NC or Ad-Tβ4. Data are presented as means ± S.D. from 3 independent experiments.

*p<0.05, **p<0.01.

Thymosin β4 regulates endothelial cell function through AKT pathway 301

Vol. 62(4): 295 - 306, 2021

9 (Fig. 4B and 4C). These data confirmed

that Tβ4 remarkably promoted the HUVECs

migration.

Tβ4 overexpression activates AKT

signaling pathway

It has been reported that Tβ4 could

regulate the migratory and proliferative ac-

tivity of high glucose-treated HUVECs by ac-

tivation of the AKT signaling pathway (14).

Therefore, we hypothesized that overexpres-

sion of Tβ4 might regulate HUVECs function

via the AKT signaling pathway. As shown in

Fig. 5, western blot analysis indicated that

the p-AKT (Ser473) level in HUVECs infect-

ed with Ad-Tβ4 was significantly increased.

To evaluate the possibility that Tβ4 exerts

its function through the AKT pathway, HU-

VECs were treated with LY294002, a PI3K/

AKT inhibitor (15-18). After exposure to

LY294002 (50 μmol/L (19)), the expression

of the p-AKT (Ser473) level was significantly

decreased, which was induced by Tβ4 overex-

pression (Fig. 5).

Inhibition of AKT signaling reduces

Tβ4-induced HUVECs proliferation and

migration

To demonstrate that the AKT signaling

regulated Tβ4-induced proliferation and mi-

gration, the Ad-Tβ4 infected HUVECs were

treated with LY294002. As shown in Fig.

6A, LY294002 reduced the cell numbers of

HUVECs induced by Tβ4 overexpression.

Fig. 3. Tβ4 overexpression reduced HUVECs apoptosis. (A) Scatter diagram and Histogram of apoptosis in

HUVECs infected with Ad-NC or Ad-Tβ4. (B) The protein level of cleaved caspase-3 in HUVECs infec-

ted with Ad-NC or Ad-Tβ4. (C) Scatter diagram and Histogram of apoptosis in HUVECs infected with

Ad-NC or Ad-Tβ4 under hypoxic conditions. (D) The protein level of cleaved caspase-3 in HUVECs

infected with Ad-NC or Ad-Tβ4 under hypoxic conditions. Data are presented as means ± S.D. from 3

independent experiments. *p<0.05.

302 Tang et al.

Investigación Clínica 62(4): 2021

Fig. 4. Tβ4 overexpression promoted HUVECs migration. (A) The cell migratory ability was investigated when

HUVECs were infected with Ad-NC or Ad-Tβ4 (200x). (B) The relative mRNA level of MMP-2 and MMP-

9 in HUVECs infected with Ad-NC or Ad-Tβ4. (C) The protein level of MMP-2 and MMP-9 in HUVECs

infected with Ad-NC or Ad-Tβ4. Data are presented as means ± S.D. from 3 independent experiments.

*p<0.05.

Fig. 5. Tβ4 enhanced AKT signaling. (A) The protein level of p-AKT (Ser473) and AKT in HUVECs infected

with Ad-NC or Ad-Tβ4. (B) The density of the western blots bands shown in (A) was quantified using

ImageJ software. Data are presented as means ± S.D. from 3 independent experiments. *p<0.05.

Thymosin β4 regulates endothelial cell function through AKT pathway 303

Vol. 62(4): 295 - 306, 2021

LY294002 enhanced the apoptosis rate of

HUVECs, which was decreased by Tβ4 overex-

pression (Fig. 6. B). Furthermore, LY294002

could reverse the Tβ4 overexpression-medi-

ated increase in the ability of HUVECs to mi-

grate through the membrane (Fig. 6C).

DISCUSSION

The novelty of our findings was as fol-

lows: (1) gene expression modalities of Tβ4

alongside its mechanism of actions in endo-

thelial cells, which clarifies the Tβ4 function

in biomolecular levels, (2) the role of Tβ4 in

endothelial cells under both, normoxic and

hypoxic conditions.

Vascular endothelial cells, which cover

the intima of the vascular wall, play an es-

sential role in maintaining vascular wall ten-

sion, repairing vascular wall inflammation

and promoting vascular proliferation, by

secreting a variety of vasoactive substances

(20,21). The dysfunction of vascular endo-

thelial cells plays a central role in the patho-

genesis of vascular-associated diseases (20).

Therefore, controlling endothelial cell func-

tion may be a potential novel therapeutic

strategy against vascular-associated diseas-

es. The results of this study conﬁrmed that

Tβ4 plays an important role in the regula-

tion of HUVECs proliferation, apoptosis, and

migration. According to the above findings,

this study revealed the beneficial effects of

Tβ4 on endothelial cells, which may provide

novel insights into the potential application

of Tβ4 for vascular protection and therapy in

Fig. 6. Tβ4 regulated HUVECs proliferation and migration via AKT signaling (A) Tβ4-induced HUVECs proli-

feration was abolished by the AKT signaling inhibitor Ly294002. (B) Tβ4-reduced HUVECs apoptosis

was abolished by the AKT signaling inhibitor Ly294002. (C) Tβ4-induced HUVECs migration was

abolished by the AKT signaling inhibitor Ly294002. Data are presented as means ± S.D. from 3 inde-

pendent experiments. *p<0.05.

304 Tang et al.

Investigación Clínica 62(4): 2021

vascular-related diseases, including cardio-

vascular, cerebrovascular, coronary artery,

and diabetes diseases.

Tβ4 has been shown to be secreted from

embryonic endothelial progenitor cells, en-

dothelial cells, and cardiomyocytes (10,22),

suggesting that it may play an important

role in endothelial cell function. It has been

demonstrated that HUVECs transfected with

Tβ4 increased the rate of tube formation on

Matrigel while silencing of Tβ4 abrogated

tube formation (23). The addition of exog-

enous Tβ4 can enhance vascular sprouting

in cultured HUVECs by inducing several bio-

logical responses (24). Ho et al. found that

exogenous Tβ4 protected bovine corneal

endothelial cells from low-dose ultraviolet-

induced oxidative stress and apoptosis (25).

Tβ4 also mediated the inhibitory effect on

endothelial progenitor cells apoptosis in-

duced by serum deprivation (26). Qiu et al.

(27) reported that Tβ4 could induce circu-

lating endothelial progenitor cell directional

migration, which is essential for re-endothe-

lialization and neovascularization. Moreover,

Tβ4 could increase telomerase activity and

inhibit the senescence of endothelial pro-

genitor cells (28). In our study, we used Tβ4-

expressing adenovirus to demonstrate the

effect of Tβ4 on HUVECs proliferation, apop-

tosis, and migration. Our results showed

that Tβ4 overexpression promoted HUVECs

proliferation and migration. Furthermore,

Tβ4 overexpression could effectively reduce

the HUVECs apoptosis under normoxic and

hypoxic conditions. Hence, both previous

studies and our results indicate that Tβ4

plays an important role in the function of

HUVECs.

It has been investigated that the molec-

ular mechanism of Tβ4-regulating endothe-

lial cell function involved various known reg-

ulatory pathways (7). It has been reported

that Tβ4 could promote the migration and

proliferation of embryonic endothelial cells

via activating protein kinase C (PKC) activ-

ity (29). Moreover, Tβ4 induced the migra-

tion of endothelial progenitor cells via the

PI3K/AKT/eNOS signaling pathway (14). Lv

et al. found that Tβ4 significantly reduced

VE-cadherin expression levels in HUVECs

through the Notch signaling pathway (30).

In high-glucose-exposed vascular endothelial

cells, Tβ4 protects against hyperglycemia-in-

duced damage of endothelial cells via up-reg-

ulating the expression of insulin-like growth

factor-1 (IGF-1) (31). In the present study,

overexpression of Tβ4 significantly increased

the p-AKT (Ser473) level in HUVECs, while

LY294002, a PI3K/AKT inhibitor, decreased

the p-AKT (Ser473) level, which was induced

by Tβ4 overexpression. LY294002 reduced

Tβ4-induced HUVECs proliferation and mi-

gration. Thus, Tβ4 could regulate the cell

function of HUVECs via the AKT signaling

pathway. Except for AKT signaling pathway,

we couldn’t rule out the possibility that Tβ4

regulated HUVECs function by an alterna-

tive signaling pathway.

In conclusion, the results of the pres-

ent study indicate that Tβ4 is a major reg-

ulator of HUVECs function. Tβ4 increased

proliferation and migration, while reduced

apoptosis of HUVECs. The underline mecha-

nism is the increase of p-AKT (Ser473) level

by Tβ4, which is demonstrated by the PI3K/

AKT inhibitor LY294002. These results pro-

vide novel insights into the role of Tβ4 in the

pathogenesis of vascular-associated diseases.

ACKNOWLEDGMENTS

The present study was supported by the

Special Fund for Medical Science Develop-

ment of Health Committee of Nanjing (No.

YKK18152).

REFERENCES

1. Wu X, Zheng X, Cheng J, Zhang K, Ma C.

LncRNA TUG1 regulates proliferation and

apoptosis by regulating miR-148b/IGF2

axis in ox-LDL-stimulated VSMC and HU-

VEC. Life Sci 2020; 243: p. 117287.

2. Chen H, Liu X, Wu Y, Wu X, Wen X, Lu Y,

Zhao X. Apoptosis in HUVECs induced by

Thymosin β4 regulates endothelial cell function through AKT pathway 305

Vol. 62(4): 295 - 306, 2021

microRNA-616-3p via X-linked inhibitor of

apoptosis protein targeting. Exp Ther Med

2021;21(6):661.

3. Jiang F, Xu XR, Li WM, Xia K, Wang LF,

Yang XC. Monotropein alleviates H2O2‑in-

duced inflammation, oxidative stress and

apoptosis via NF-κB/AP-1 signaling. Mol

Med Rep 2020;22(6):4828-4836.

4. Nie J. inhibits high glucose induced apop-

tosis in HUVEC by targeting Rab4. Biomed

Pharmaother 2020;131: p. 110662.

5. Mi L, Zhang Y, Xu Y, Zheng X, Zhang X,

Wang Z, Xue M, Jin X. HMGB1/RAGE pro-

inflammatory axis promotes vascular en-

dothelial cell apoptosis in limb ischemia/

reperfusion injury. Biomed Pharmacother.

2019; 116:109005.

6. Low T, Hu S-K, Goldstein AL. Complete

amino acid sequence of bovine thymosin

beta 4: a thymic hormone that induces ter-

minal deoxynucleotidyl transferase activity

in thymocyte populations. Proc Natl Acad

Sci 1981;78(2):1162-1166.

7. Dubé KN, Smart N. Thymosin β4 and the

vasculature: multiple roles in development,

repair and protection against disease. Ex-

pert Opin Biol Ther 2018;18(sup1):131-139.

8. Kupatt C, Horstkotte J, Vlastos GA, Pfos-

ser A, Lebherz C, Semisch M, Thalgott M,

Büttner K, Browarzyk C, Mages J. Embr-

yonic endothelial progenitor cells expres-

sing a broad range of proangiogenic and

remodeling factors enhance vascularization

and tissue recovery in acute and chronic

ischemia. The FASEB J 2005;19(11):1576-

1578.

9. Smart N, Risebro CA, Clark JE, Ehler E,

Miquerol L, Rossdeutsch A, Marber MS,

Riley PR. Thymosin β4 facilitates epicar-

dial neovascularization of the injured adult

heart. Ann N Y Acad Sci 2010;1194(1):97-

104.

10. Smart N, Risebro CA, Melville AA, Moses

K, Schwartz RJ, Chien KR, Riley PR. Thy-

mosin β4 induces adult epicardial proge-

nitor mobilization and neovascularization.

Nature 2007;445(7124):177-182.

11. Smart N, Risebro CA, Melville AA, Moses

K, Schwartz RJ, Chien KR, Riley PR. Thy-

mosin β4 is essential for coronary vessel

development and promotes neovasculariza-

tion via adult epicardium. Ann N Y Acad Sci

2007;1112(1):171-188.

12. Wyczółkowska J, Walczak-Drzewiecka A,

Wagner W, Dastych J. Thymosin β4 and thy-

mosin β4-derived peptides induce mast cell

exocytosis. Peptides 2007;28(4):752-759.

13. Sun C, Feng SB, Cao ZW, Bei JJ, Chen Q,

Xu XJ, Zhou Z, Yu ZP, Hu HY. Up-regulated

expression of matrix metalloproteinases in

endothelial cells mediates platelet micro-

vesicle-induced angiogenesis. Cell Physiol

Biochem 2017;41(6):2319-2332.

14. Qiu F, Song J, Bi X, Wang M, Zhao Y, Fu

G. Thymosin β4 promotes glucose-impaired

endothelial progenitor cell function via Akt/

endothelial nitric oxide synthesis signaling

pathway. Exp Ther Med 2018;16(4):3439-

3444.

15. Dong W, Luo B, Qiu C, Jiang X, Shen B,

Zhang L, Liu W, Zhang W. TRIM3 attenua-

tes apoptosis in Parkinson’s disease via ac-

tivating PI3K/AKT signal pathway. Aging

(Albany NY) 2020;13(1):735-749.

16. Wang Y, Lin Y, Wang L, Zhan H, Luo X,

Zeng Y, Wu W, Zhang X, Wang F. TREM2

ameliorates neuroinflammatory response

and cognitive impairment via PI3K/AKT/

FoxO3a signaling pathway in Alzheimer’s

disease mice. Aging (Albany NY)

2020;12(20):20862-20879.

17. Xu L, Chen J, Jia L, Chen X, Awaleh

Moumin F, Cai J. SLC1A3 promotes gas-

tric cancer progression via the PI3K/AKT

signalling pathway. J Cell Mol Med 2020

;24(24):14392-14404.

18. Zhu S, Liu X, Xue M, Li Y, Cai D, Wang

S, Zhang L. 20(S)-ginsenoside Rh2 induces

caspase-dependent promyelocytic leuke-

mia-retinoic acid receptor A degradation in

NB4 cells via Akt/Bax/caspase9 and TNF-α/

caspase8 signaling cascades. J Ginseng Res

2021;45(2):295-304.

19. Zhou P, Xie W, Luo Y, Lu S, Dai Z, Wang

R, Sun G, Sun X. Protective effects of total

saponins of Aralia elata (Miq.) on endothe-

lial cell injury induced by TNF-α via modu-

lation of the PI3K/Akt and NF-κB signalling

pathways. Int J Mol Sci 2018;20(1):36.

20. Rajendran P, Rengarajan T, Thangavel

J, Nishigaki Y, Sakthisekaran D, Sethi

G, Nishigaki I. The vascular endothe-

306 Tang et al.

Investigación Clínica 62(4): 2021

lium and human diseases. Int J Biol Sci

2013;9(10):1057.

21. Palmer RM, Ashton D, Moncada S. Vascular

endothelial cells synthesize nitric oxide from

L-arginine. Nature 1988;333(6174):664-

666.

22. Kupatt C, Bock-Marquette I, Boekste-

gers P. Embryonic endothelial progeni-

tor cell-mediated cardioprotection requi-

res Thymosin β4. Trends Cardiovasc Med

2008;18(6):205-210.

23. Grant D, Kinsella J, Kibbey M, LaFlamme

S, Burbelo P, Goldstein A, Kleinman, HK.

Matrigel induces thymosin beta 4 gene in

differentiating endothelial cells. J Cell Sci

1995;108(12):3685-3694.

24. Grant DS, Rose W, Yaen C, Goldstein A,

Martinez J, Kleinman H. Thymosin β4 en-

hances endothelial cell differentiation and

angiogenesis. Angiogenesis 1999;3(2):125-

135.

25. Ho J, Su Y, Chen KH, Lee O. Protection

of thymosin beta-4 on corneal endothelial

cells from UVB-induced apoptosis. Chin J

Physiol 2010;53(3):190-195.

26. Zhao Y, Qiu F, Xu S, Yu L, Fu G. Thymosin

β4 activates integrin-linked kinase and de-

creases endothelial progenitor cells apopto-

sis under serum deprivation. J Cell Physiol

2011;226(11):2798-2806.

27. Qiu FY, Song XX, Zheng H, Zhao YB, Fu

GS. Thymosin β4 induces endothelial pro-

genitor cell migration via PI3K/Akt/eNOS

signal transduction pathway. J Cardiovasc

Pharmacol 2009;53(3):209-214.

28. Li J, Qiu F, Yu L, Zhao Y, Fu G, Zhou B.

Thymosin β4 reduces senescence of en-

dothelial progenitor cells via the PI3K/Akt/

eNOS signal transduction pathway. Mol

Med Rep 2013;7(2):598-602.

29. Bock-Marquette I, Shrivastava S, Pipes GT,

Thatcher JE, Blystone A, Shelton JM, Ga-

lindo CL, Melegh B, Srivastava D, Olson

EN. Thymosin β4 mediated PKC activation

is essential to initiate the embryonic coro-

nary developmental program and epicardial

progenitor cell activation in adult mice in

vivo. J Mol Cell Cardiol 2009;46(5):728-

738.

30. Lv S, Cheng G, Zhou Y, Xu G. Thymosin

beta4 induces angiogenesis through Notch

signaling in endothelial cells. Mol Cell Bio-

chem 2013;381(1):283-290.

31. Kim S, Kwon J. Effect of thymosin beta 4 in

the presence of up-regulation of the insulin-

like growth factor-1 signaling pathway on

high-glucose-exposed vascular endothelial

cells. Mol Cell Endocrinol 2015;401:238-

247.